Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35G12.8   

sjj_F35G12.8 RNAi JA:F35G12.8
Simmer:F35G12.8
PF:GL1_4C11
PCR_productsjj_F35G12.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.8 Source_evidenceePCR962WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.8 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Chunk_score Abs_score950
Max_abs_score950F35G12.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45916834592857
Overlaps_transcriptF35G12.8 Source_evidenceePCR1034WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35G12.81175gaaaacatttggttgccgttttcaaaatgctaactgacggaggagatgccaaattggaatacattgataaagacgatccattccgacaaggaatcagttttatggttcgcccagcgaagaaagcttggaagcaaattcaattcctttcgggtggagagaagacattgtcctcattggctctcatttttgcgctccacatgttcaggtactaaatactttctttaataattattataatccctcgtttagacctactccattctacgttatggacgaaatcgatgctgctctcgactatcgtaacgtttcgattattgcccaatacgtccgacaaaagactgaaaacgcgcagtttattattatttctttgagaaataatatgtttgaactcgccaatcgtctcgttggtatctataaagttgatgggtgtactcgtaatgtagccattgatccattgagagtttgtgagatggcgaagcaaattacggacagtttggggcaggccacgtgtactcttcctgatgaagtaactcaacgattcaatgagacaatgagtcggcagaataaggaaatgattgcacaagaaaaacaatatccgaacttcccatcatcaaatgagatttcaaaggccgaaaagattgttaacgttgaaggacgtgtcaggaaagaattgattcaaactacccgagatgtcacttcaagaccacaatccaaagcaacgacaagtggcgatggaactgaaagaccggctagtcggtcagcaagtcgacccgaatctcgtataaatcgtaagaccaatggcgtatttattatgaaaatgaaacaacttatttttagaaatgaaatatcctgctccacgccttgtcgaaagatcgtcgtcacagaatgttcgtagcccgagaaaggcacgaaacatagaggccgatgaggttagtttcattaaaaaatttgagactcattttatttcccattttcagactactccaccttcaaagcgttcaaattccgcaagtacaccaaaacgatctccaatgaaaccgttgacaccgtcgagtaaaaagaaggagaaggcaatcgttgatgacgatgatgatatggaataattcattcaaaaaagttctatcctcttttgttttgacgggtattagttctctgatccctcgactcttccgttt