Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36A2.10   

sjj_F36A2.10RNAiJA:F36A2.10
PCR_productsjj_F36A2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F36A2.10 Source_evidenceePCR456WS150 Sequence/Annotation Release
F36A2.9a Source_evidenceePCR105WS150 Sequence/Annotation Release
F36A2.9b Source_evidenceePCR216WS150 Sequence/Annotation Release
Overlaps_Gene F36A2.10 Source_evidenceePCR514WS150 Sequence/Annotation Release
Chunk_score Abs_score451
Max_abs_score451F36A2.10
Specificity_index0.745
Rel_score1
Map_statusBest_ePCRI88195208820560
F36A2.9 Source_evidenceePCR216WS150 Sequence/Annotation Release
Chunk_score Abs_score154
Specificity_index0.255
Rel_score0.341
Map_statusBottom50_percentile_ePCRI88195208820560
Overlaps_transcript F36A2.10 Source_evidenceePCR514WS150 Sequence/Annotation Release
F36A2.9a Source_evidenceePCR105WS150 Sequence/Annotation Release
F36A2.9b Source_evidenceePCR216WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36A2.101041tcccggaaagatctcttttctaccttgccatcaagaagcgacgattatttacttgtgagccgcagacacacgacgggcggttttgctgcttccactgaaaattgactatgaatattagaataaaactgaaaaaaacaaaccgcgatttgatggcttctgtctttttcactttgacgggagagatagatcgagcggctttcgtggtaactgccttctttggagcacgcttctttccacgagtgctactgcggcttcgagatctcgatctggaacgtgagcgagtagactttgaacgtgagcggcgagtagatttcgaacgggatcttgaacggctacgagatgatgccttctttttcaacttctccttcggaattcgagatgaactggtcgaagtcgaagagtcagtgatccccatatgtccacgaagagcagcctgagagcgagtaaccgctccttgggtgcggaccgttggtcggacagcttgaatcgtcttctttgtagatcctggacctttagatccgacttttgccacggtagtctttcttgccattgatggatttcttcaagtatgcgaatatgtcgaactaatgattgttttgtggttttggtcgaccttgtatagacattcatttgaccgggcgaaaagaataattaaaccatgtcacgagaaattagaaatgaaacataaataaatgtttttcaaatttttggttcaattttttttttgaaaattgtttttttaagggttgtccgtatttccgaacgtatgagaatcacaagagatgttccactatgagccttcaacaagcaaaagaagaattaattgatataaatgggacttttacaaaggtttgtttgatgttgtgaatgcttttacttttaattttgtatattctgcatgtattgatattgtagcctcgtcgacgctcggttcggttcttgtacaacgtggcaatggtggttataggtgcagccttttgtgctgcctgcctgctcggaactttcttttatcaaaaatccaaagcggtatgcaatctatac