Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36H12.15   

sjj_F36H12.15 RNAi (5)
PCR_productsjj_F36H12.15
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36H12.15 Source_evidenceePCR237WS150 Sequence/Annotation Release
Overlaps_Gene F36H12.15 Source_evidenceePCR237WS150 Sequence/Annotation Release
Chunk_score Abs_score180
Max_abs_score180F36H12.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV52680185268637
Overlaps_transcriptF36H12.15 Source_evidenceePCR237WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36H12.15620gagagctgctttaaatgtggaaaaaaatactaaaatgaagagcgattgcagagaaattatgataataaatttgtatccgtttaaccaagttataagtagtttattaagtttttacttgaaatagttgatagtaagttttccggtctttcttcttccaaaatgaattatgagaatcactgaaaaatatattagtaatatttattagtaataaaaatatttaaatgaaacaacttactgcaaaccacgagaagcagaagcaccaatccgatggtaattgcaacataccacgtggcaatttctccaggaatccagagagtaaatgtggttgtagtggatgatttgatgaacatgtaaacggtagttggatctatttccacaagggagcatgttgtctggaaaataaacaattaatgttttaaagaggaggaacaaggagaatccctgtgtttttgacgaaatttacttgcaaaaagatcaccaaatttaaggggatgaaaaataattttaatttcgcacaatatggttgtacatactatactaatacatttaaccacaattttacttaaatgctgaaacagtaatgtttttgtttgcttaaaggaaaagtgcactgaaaatga