Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F37D6.1   

sjj_F37D6.1 RNAi JA:F37D6.1
Simmer:F37D6.1:Repeat_b
Simmer:F37D6.1:Screen_A
Simmer:F37D6.1:Screen_B
PCR_productsjj_F37D6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37D6.1 Source_evidenceePCR707WS150 Sequence/Annotation Release
Overlaps_Gene F37D6.1 Source_evidenceePCR707WS150 Sequence/Annotation Release
Chunk_score Abs_score603
Max_abs_score603F37D6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1048403610485101
Overlaps_transcriptF37D6.1 Source_evidenceePCR707WS150 Sequence/Annotation Release
WB_DNA_textsjj_F37D6.11066ctcacgagcccttcaaaaactctcaatgcataggaattaactgaatcccgcgataaagcactaaatctgcccattgtggtttgagaagtttcccagagatcatcaatccatccgattcgcattaatttgattgaattattgacagcagcctggaatttttttattttattttaaatttctgcttgatatactatttaaccttatacttttccgtctgttctgctttttcagttactaggtgagtcgtttcgtgatatagagcatctccaaccactccacacatccatccgattttttcgtagagttcttgctttttcgtaagattcaacccggtgaaactgatttttacgtcttgaaaaacactggaatacactggatgattccattgtgggagctgcttcccatcttcgatactttcaagaacaattggaggaccgtatactctgaatattgtaattttattttgtggacttgaatttatttgaatttaatttaacacaaacttcaatttccgggcttgaagttttcgaaaaagctttccgcggaaacagggtaaaacgaaaaagtcttcagatttctgcagatcttcgagtgcatctgaatcaatccattctggcatgattcccacagcttttgcagtctgaaaatacgcctaaaacttgaaaaataaataaattaataacgcaatactttgaataactcttctaaattgcgaatttctttgactgttggttcattgggaagatcgacaaagtacaatgtgaacggagaatcttcttcatcgtcatcgcaaagcaccgactcgtcttgcatcctactgacctgaaatttgaagttttgatattaaaattgttgaaaatcagatataattacctcactccttcgtgccttcttcggggccggaggtgcctccattgtaaaatctggaatattttgataataaaaaaagctaatttcgccagtaaaaaactcaagaattggcagggtagggtgttaacattaagttcaaaaatgacagtttcgcgcgtgtgaaatgcgaacagacacgacgggaagtggtatgact