Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F37E3.3   

sjj_F37E3.3RNAiJA:F37E3.3
PCR_productsjj_F37E3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37E3.3 Source_evidenceePCR711WS150 Sequence/Annotation Release
Overlaps_Gene F37E3.3 Source_evidenceePCR711WS150 Sequence/Annotation Release
Chunk_score Abs_score564
Max_abs_score564F37E3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64302896431482
Overlaps_transcriptF37E3.3 Source_evidenceePCR711WS150 Sequence/Annotation Release
WB_DNA_textsjj_F37E3.31194gccccagaaatttgtcttgacttttgaagtataacaacataagactgtttttaagaaggttcgaattgttatgtttcgtcctaattctgaaaagtcaaaccttgattctttgtgccaaatccaaatgagtatcaaagttcttcaagaaatctttcaatgaacatccaacttgattttcttgatgcctgtaataaatttataattttcatcctctcattaaatatctcactcataaatcaatgttggtgggttgagaatagctccaattggaagacgaattggaaggtttctcgctgccaatgcttttccctcgacaagattctgaacttgatttaatttggaaaatagctttgaaaagttttcaacaaacctcatagaacactttgaggtctgaaatagtcgggttatgaagttcttcgaacaatgctttcttgatctttccatccgcaaacttcatttctccagtataaacctttaaattaatgaaattgagaaagccgagttacctgtctctctaaaaaaattgtcaaactttcaactgtttttttaaattcgagtcatattcgagttttcgattttctcaccaaatgaaagaaatcctgcgattgaattttcttatctttgattctttttcctgtcttgcaaatgttgtgcacatttgtcgaagaaagtccaagaagacggttcattgaaatgttctcatccagtacaccaccaagaatgtcggtctgaaacagacatattaaaaaacgttcaacgagacaaaaaaaattacaaagtcattcttgagatgatagaccaattgttcaagtgtctgagaacgggcaaacaacattccttgaatagcgtattcatttctgaaactatattttcagcttttgttatttttaatgtattccatactcagaatgatcaatacgaagatgaatggcacgagaagtttcctttttcatcttattatttccaggaacaattgaaagataataggcaccatccagtgatttcgacatactgaagtcgcctaaaaagtttttaaatcgttttaaaatattactttatagtctcaaaaacaacgttttgcaaatttaactattttcctcacgaacctggatttttgagcacaaaagcttcaatgaaagtgatgggaacattgttaaaaatggcatccttaatatcgtcatcattttccatcga