Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F38E9.4   

sjj_F38E9.4 RNAi JA:F38E9.4
[cgc5655]:daf-2:F38E9.4
[cgc5655]:F38E9.4
[cgc5655]:tph-1:F38E9.4
PCR_productsjj_F38E9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF38E9.4 Source_evidenceePCR618WS150 Sequence/Annotation Release
Overlaps_Gene F38E9.4 Source_evidenceePCR618WS150 Sequence/Annotation Release
Chunk_score Abs_score597
Max_abs_score597F38E9.4
Specificity_index0.585
Rel_score1
Map_statusUnique_ePCRX1645147416452550
Y73B6BL.16 Chunk_score Abs_score423
Specificity_index0.415
Rel_score0.709
Overlaps_transcriptF38E9.4 Source_evidenceePCR618WS150 Sequence/Annotation Release
WB_DNA_textsjj_F38E9.41077tggcagtttgatagcgtaagattccattatcacaatgattcaaaaaaaagaattcaagttcaattaataggattaaccggtgaaaacaagagtttttgtttttttgcaaccgttgatttatacaattctctacgtcgtccattgtaataatgaaaacaaattgacaattttttgcaaagttgtgacgttaggcaagtaaattttgaattttgttgtacacaatgtgtttttatacactcgattttagttttaaaaaatgtgtttaaagatggtcctcgtcctcccgttctcccactcgtcctcccgttctccccactcgtcctcccgttctccccagcggtcggtcgcatattgttcttgctctcgtatcgatttttgccgaaatgcccccacccgatgacgacatgatagttgattcttcaccaactgctacaattccgcctacttgtgacaatattctgcgaaatcaaaacttgccatcaacaccagcttccggacagccaagtatcaaggaattgatcgaacgaatcaccattttggagaaaactgtcaaggaacaatcgaagaaaattgccgagttggaagctactaaaggtttcccattaatcaccaatgatgctagcaaaagtaagagtaaactttactccgctgtagtccaaaacgaccctcaatctgtgaaaatcatcgaaaaggctcacttcgctgctgatctccgaaagctcggggaaaactcgatttacgcgattattgagaatgtaccggattgcaagaaagaagaacaaacgacaattgatgcctcactcatggaaaacttagccaagctggatactcttccgaaacctgaacaattcttccgaatcaaatgcaaaaaaccggatgttccttctcgccctctcaaggttaagtttgctactgaatatcaacgggatactttcattcgacaattttccaaggcacttcacaatcttcctgaacgcccagtatcgtctcgaactatctgatgccggagagacatgtcgcccgaagaacttatactgctcaaacagaggcgagctacagcctatgaggaaaaccgta