Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.10   

sjj_F39B2.10RNAiJA:F39B2.10
PCR_productsjj_F39B2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F39B2.10 (3)
Overlaps_transcript F39B2.10.2 Source_evidenceePCR968WS150 Sequence/Annotation Release
F39B2.10.3 Source_evidenceePCR968WS150 Sequence/Annotation Release
F39B2.10.1 Source_evidenceePCR968WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39B2.101071taaaatggcgctcaaattccatccagacaagaatccagacggagctgagcaattcaagcagatctcccaggtttgttacgaaatccagctgcaaagttgaaattactcatattgcaggcatacgaagtattatcagatgagaagaaacgtcagatttatgatcagggtggagaagaagcacttcaaggcggtggtggtggcggagagggattccacaatccgttcgacgtattcgacatgttcttcggaggcggtggtcgtggtggtcgtggagaacgtcgagtaaaaccaacggttcacaatttacgggtcacactcgacacactgtacaagggtgttacgaaaaagctgaaaatctcaagaactgccacttgtaaaggatgcaagggacttggaggcaacgagggatccgctaaggagtgctctgattgtcgtggacgtggaatcaaggttcgtgttatcagaatgggaccaatggttcaacaaatgcaatctcactgcgacagttgtaatggagaaggctcaacattccttgaaaaagatcgctgcaaaaagtgtaacggaaagaagcaggtttgacttttctccaatcgaattcgaaactataattagtgatttcaggtgaaagaagacgaaattattgaagttggaatcacgcctggcatgaaagatggcgagaagtttgtgttcgaaggaaaaggagacgaagtgatcggtattgagaagcctggagactttgtagttgtgctcgacgaggttgaacacgagaaattcgtccgaaaaggcgataatctgattattcaacacaatatcgatctttccgaggctctgtgcggatttgtgcgaacaatcagtacacttgatggtcgaacaattttctatcgtgttcttcctggagaggttattgctcatgccgatgttaaagtgatccacaacgagggaatgccaatgcgtcgagcatcatctgataaaggagatcttctcgtacagttcgatgtgaaattccccgataaaattaatccagatgccgcgaagaagctagccgatttactgcctggaaagagttcgttt