Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.2   

sjj_F39B2.2RNAiJA:F39B2.2
PCR_productsjj_F39B2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F39B2.2 Source_evidenceePCR515WS150 Sequence/Annotation Release
Chunk_score Abs_score452
Max_abs_score452F39B2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1479017614790847
Overlaps_transcript F39B2.2.1 Source_evidenceePCR515WS150 Sequence/Annotation Release
F39B2.2.2 Source_evidenceePCR513WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39B2.2672tgatttttcggattttaaagcaaatttctttgttaataatttcaattttcagcgttccagcaacttgggcactttcaaaatgggtaagttcgctttctaaattcaaaaatgattattttcgcatatttttctcttttccagtcgatgtaccacgcaatttccgtctgctggaagaacttgaagaaggacaaaaaggcaagggagatggaaacatttcgtggggtttggaggatgacagcgatatgactctcaccagatggactgcttccatcattggtccaccgagagtgagtcagcggaattaatcattttttattattagttttttgctttcagactccatacgaatcgcgaatctacaatctgcaaatccagtgcggcgggaattatccgcgagagccaccaaccgttcgtttcaccaccaaagttcacatggtgggagtcaatcagagcaatggagtgattgataagcgaaatttgacaacacttcgcaactggagcaatagttacatgatcaagaccgtgctcgaggatatccgcaagaacatgatgatggccaaagagaatctgaaattgcagcaaccggcagagggcgccatgttctaaattcttttattgattttttgtatacccagtttactctccccggtagtagctttcccctcgaacttt