Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39H11.2   

sjj_F39H11.2 RNAi JA:F39H11.2
Simmer:F39H11.2:Screen_A
Simmer:F39H11.2:Screen_B
PCR_productsjj_F39H11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39H11.2 Source_evidenceePCR597WS150 Sequence/Annotation Release
Overlaps_Gene F39H11.2 Source_evidenceePCR597WS150 Sequence/Annotation Release
Chunk_score Abs_score513
Max_abs_score513F39H11.2
Specificity_index0.84
Rel_score1
Map_statusUnique_ePCRI86998688700816
ZK1236.6 Chunk_score Abs_score98
Specificity_index0.16
Rel_score0.191
Overlaps_transcriptF39H11.2 Source_evidenceePCR597WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39H11.2949tttacaatccgcctcactccggcaaccaacaatatatacttttccagaactatatactttgatataacaaccaggcgatcttttttgtttcatcattactcctttttctctttcatatgtcacgttatgagtgttcattgccaattttcgaagatcaatgtgcaaagggagtgtataattacaaacaacatttcgaatctggaatattttcaagttttgatgattgattgctgttagaaagtacctgaatatcgatatcaccatcatctggcattggttcctcattggcagccgatgtaccttctggaggaacatctggaacctcaattttgacaggaatctgaaaaatgtagatatgaaacatgaaaatgtacattcatctgttaccggctcaggtgagggttctctcagtggcactgccaaattcatgtcacgcggcacataaatctgcggatgtggctgctgagcatggtgttgggccatctgatgacgtgtcatttgtggttgaaccatttgatgttgctgattatggtgcatttgtggttgacgatgttgcataatcatttgattttgttgagaaggatgattaaaatgttgtggttgctggtggtgttgttgttgattctgtaatatcctctgattaattttggtgaatatatctgaaccagccgtggaccgcacctacggcgcggcccccgacttttttgagaaaacacattagatatacggtgtctatcgcggacctcgatcgatgtctgttgcgcatttagcataaggtttcccaaaatttcgttgctctgatcagagatcaaactacatagggacagaaggacacgcgctttatatatagtaaatgatagtaaatgataatcatgaaacatacctgttgttgttgtcgatgttgtgcttgcgcatagcttatctgttgttgtccttgctgattttgtgc