Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39H2.4   

sjj_F39H2.4 RNAi JA:F39H2.4
PF:GL1_4C2
PCR_productsjj_F39H2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39H2.4 Source_evidenceePCR555WS150 Sequence/Annotation Release
Overlaps_Gene F39H2.4 Source_evidenceePCR582WS150 Sequence/Annotation Release
Chunk_score Abs_score498
Max_abs_score498F39H2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86631998664226
Overlaps_transcriptF39H2.4 Source_evidenceePCR582WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39H2.41028cattttggctgttctgattcttttaattcatgtagaaagtcgggctttcagagcttcttcttgtagacgacatttttggtactcactgcgcagtttggcaacttgataatggaaaataatgcgaagagtgttgcgctctttgtaggtcgctccacatgttggacggagagaaggaatcatttcagaaatagtcgatgattgatcagcgatggcgacttctagttgtttctctgcaagtttagttgataataccatcaaaattttttttcaacttactttcaatgtttaattcatccagattgtttttgagtgaattgaattgaccattcatcgaatcatgtgactgaaaatataacattcagaaacccactctttttaaaaattataaagttatcgagcagacttaccaagttgttcatcgatttaattaatgaattgaagtgatctccgaactgtgtacccgcactgtccacatcctcgttttccaaataagacattagttcatcataggctttttcttgtctctcttcccagtctcttttctgttcagacagtttattgtcagttgctgtcaaatcctgaagctgtctttctagactttctcgttgagcagcacatttaaccctgtcttcagcaattcgctcggtgaatgaagtttcggctgaagaaaattttaaagttgagcctttttcaatctgtcaaaccttcaagctgttgagtttcgatttgcctcattcctttttctatggcctctgaaaatgtatttttaaattcatatttcattgatgtttgcctcaaaacatacctctttccccagcgagcgagttggtgaactcagtgagctgcccgcagaaaattttgaatcggtcaccatttactgcctgactgacaagcttttcgaaattcatttatctctgaaattggagatattgaaatggccaattcacaatagaaaataaaaatatttaaaattaacaaaaaaccgtagcgtgtttgcgatcgttgcgagacccacatgacttaagaac