Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F40G12.11   

sjj_F40G12.11RNAiPF:GL1_1B10
PCR_productsjj_F40G12.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF40G12.11 Source_evidenceePCR753WS150 Sequence/Annotation Release
Overlaps_Gene F40G12.11 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score731
Max_abs_score731F40G12.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1428917214290324
Overlaps_transcriptF40G12.11 Source_evidenceePCR753WS150 Sequence/Annotation Release
WB_DNA_textsjj_F40G12.111153aagcagtgtcgcatgttcagacccctaaaatgttttaattagaattagtcaaacaaaattacggtaaaaaaatgtcggaaaacaatcttttttcttgactcccaaaattatgaatggcaaaaactgactgttactttttttttaattttttttttaaattgttactttttgatagtaaatgagaaattttcaaacattttttggaaagttttattttgatatttggtaattttggcaccataggggtagttttaaaaacgttccaaactatttcacctttaaatactggaaaagtaaatcttttcaaatatttttttatccgaacgatttcgaaagtgcaacttgttttaaaagataattttgtggaccaatcttcaattaaaaataattgatttttcaggatactaaacaatcgacgagactattaaatgaggatcaggatcgggacactctcttgaaaaaacacgtggattctttgtacgctctaagcgaacgatgtattatttttgccggcgtgttaaatcagtttttaccaaccgaaaagcggcgttcaaaaaccgatttccttacggaaaacatgttagccgcgcttttatctgaacttataactcaaattgaggtatctgatttgagagctaaagctaatccagcagttggaaaacaagaaggcgatcgatgtaaagaactggtttccgaaaaatcctgcatagaagagtcacttcgaaactttcgagagttcgcaaaagaggatagtaaaactgatacttcttcaaaattggatccgccaaatctgaatactcttttgtaccaattggaagggatagaaaagattatgaacagcattcaaacaacacttgaggcaaataatttcaatgattctgaaaatggctcaaatgaagttacgccaaacaaatctcaactggaaggtgactcgttgaaagaagttccatcagaagaatctcaaatagtcgattcagcccatgacggagattcaaggaaagaaggtgaatcggaggtatcagaaatggacaacgtcgcactggacaaagatttacccgaagaaactgaaacagataaaactcttgtggacgaaattccgctggaagatttggacaaagaaccactggacgaaaatccactcgaagggtctcct