Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F41D3.4   

sjj_F41D3.4 RNAi JA:F41D3.4
Simmer:F41D3.4:Repeat_b
Simmer:F41D3.4:Screen_A
Simmer:F41D3.4:Screen_B
PCR_productsjj_F41D3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF41D3.4 Source_evidenceePCR778WS150 Sequence/Annotation Release
Overlaps_Gene F41D3.4 Source_evidenceePCR778WS150 Sequence/Annotation Release
Chunk_score Abs_score673
Max_abs_score673F41D3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1225595012257100
Overlaps_transcriptF41D3.4 Source_evidenceePCR778WS150 Sequence/Annotation Release
WB_DNA_textsjj_F41D3.41151cgacaacatcggattaccctcacatgttagcattaagcagcctgttccaatagtgactagtggtctgaaaataactttgcaatcagggccagcttctagtgcaagcttggcccaaaacatataaacatggttcagaagtttggacccaaacttgatttgttgagccaaaatttggctaattttgggcgaacttttgtcccagtttatccaaaacgtttccaacttttgaaccaagttaatttttttaagccaatacgcaagtgccgaggtctgtacctgataattgaagcatcaagtgggattggaaaaaatgccatgattgtcagtgctgctaagaaaatatagctcttatagctctcctggagcttgcacttctcttcctggtccgtaagaattttatagtgccgcttcagctttgagcatccaatattgtaaattagcattcctattataaactgccaaattcttgccagcacactattaaatgccactggcgcaggcgagaaatggaagaataggtaggacgcaaggcctgaaaaaaaaaatagaattaaatagtatcgctgaagggattcttaccaataattgtataataaggattgtgaagttttgctggtagcttagttccaattagatacatagacgggactagtacataaaactgaacttcaactgacagggaccatgtatgagtgaaaatgtccattgccatggagagctgaattattgagattgagatgggcttttcttaatatttcatgaaaactcaccatagaaaaataatcatcctccaatgtcgatgccctattagatatgaaaaacagagctcttgttgcagatttctggttggaatcaatggaaatatccgggaagaagctatagagcccgatcatgccagccaaaatgaccaggaagtatagtggaaggattctttttaaccgcttgtagtgaaaagttctgataagactgaaagccggctcattttcggatcgtctgagcagcatgcacatcaggaatccggataggacaaagaatctggaacaggaaatgaagatatgattgaagaagatactcataacttttaaataataacttactgatcaacgccgagataaccattcggaaaagctcctgggtagaaatggaagcca