Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F41D3.9   

sjj_F41D3.9RNAiJA:F41D3.9
PCR_productsjj_F41D3.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF41D3.9 Source_evidenceePCR759WS150 Sequence/Annotation Release
Overlaps_Gene F41D3.9 Source_evidenceePCR759WS150 Sequence/Annotation Release
Chunk_score Abs_score697
Max_abs_score697F41D3.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1227301912274033
Overlaps_transcriptF41D3.9 Source_evidenceePCR759WS150 Sequence/Annotation Release
WB_DNA_textsjj_F41D3.91015tccggtagtcttggaaatcgttgagcagaagaaggttcagaacagattggtcaaatctgaaactactagaaagttgaaagagaagatggtttaaattctttacctgaagcaatgccccggatgcttgtaccgatcccgccggaacacacaccgcagccgagatcctggcgggttcatgcactcctctgtaagagcgcacaggatccaccatttaaataattgcatggtatatctggtccttgggaggaagatcaatccggcggcgacatgtctctggcgctgaagaagcctcatggagcttgttggaaagtaggtaaggactgctggatttagaactgcaaaattgctatgactagtatcagataaggatacgacggaggcgaagtaagaactatttctcttgagaattatctccttttgtagattcctcgaaatattcgacttaagtaattcaatatgcgcatcgatccaccatacggctttgtactccttgagcatctgcgccatgagcagtggcttgaagttgtaggtgagccagttgttcacaaagctcgggtactgagaagtgttgaagactcggaactcgaaatgtttatctctttgcggaagtttctcgatgaaggcttcactcatgtttaggccatagaggatgtatttgtggcgtggatggaatcttcgaactgatttgtaagatttcaggctgaggtgcatgtgatcatcggaagtggaggatgcaaagactacgttactctgatttcggaggacatccgtgacatttgataggcgagaatgatcagagatgatacctgaaaaatagtactggattggagggattaaaggacaatccgtcttcaaaatcatcactagttttccgtgagtttttttttcaaatttagggtgtcttataccaagaactatacctagtcgataaccatctccgctaaaaatgagacgtcaatcgaagttcacgaagactttttctatgtattgtttgatctcttaatgcagcgggatt