Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F41E6.4   

sjj_F41E6.4RNAiJA:F41E6.4
PCR_productsjj_F41E6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F41E6.4a Source_evidenceePCR723WS150 Sequence/Annotation Release
F41E6.4c Source_evidenceePCR723WS150 Sequence/Annotation Release
Overlaps_Gene F41E6.4 Source_evidenceePCR725WS150 Sequence/Annotation Release
Chunk_score Abs_score642
Max_abs_score642F41E6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV86100748612304
Overlaps_transcript F41E6.4c Source_evidenceePCR725WS150 Sequence/Annotation Release
F41E6.4a Source_evidenceePCR725WS150 Sequence/Annotation Release
WB_DNA_textsjj_F41E6.42231aactgacgatcaagcgtctactctctatctctcacttcctgcgcctctctgtacttcgatcgacattcatttttctgcctttttcggtgaccttgaaccaagtgttatgacgaactgaagttgataatggggtcacatttcatactttcttcgcgggtctatgaaaatgttacgcgtgttgtgattagtatcagaattttattttttttaataattcaggataactcctctttaatttttatgctcagacatcactcttccgatttggaattgtagttacattttcggaatttattaattatctctaatttaaggaatgtcggacacaaaagaggtatctgatgatccgatggagcttggaacgagttcaacagttatcgctaaggaggaaaatgacaaggtgaggaaaggttgttattgttgactctgcacgtttagttttctaactcacaatttctcgaccaccttgtttgtacggatattttccgtagtctgacagagtgcgagagagttcgagagtaagaagatttcattatgaattggtgaggtcataaagacgatttcgccgagaaatccccgatatcctcacaggaattagctaaatatatcaaagttttttattttcaggaaagcctgaaaagaatggaagtagacgatgagaaagaacctgaagaagaaatcgttgagaaaactgaagagaaacaggaagaagaagacgtgacagtaaagctagaagatgaaacagaaactgaggtggaaagtgtggatggtggtcaagaagaaaaagaagttgttgatgaaaaacaggtggatgcagagcgagtaaataccaaaacagaagagttatcaccgaaaaaagaagttaaagcggaggaagatcctgaaactgaaacaaagaagaaggatccttctgagcaaacgaatggtcaggtcaaaaagaaaagtgataagcagagtccaaaaaagaaagagaaatctgagggaaaagaaaatagtcccggctcaaagctcaccaacagagatcatattcttgaccatcttgatataaaacgagtaagtaaaatgaaaaattgaattaaaaagatataatatggtttcaggacgcaaccaaccgtgtgaagctttacgttctctgcgatcaacgaatctgggaggaccgaggtactggtcatgtcgtcactcatcagttatcagctgaagatggagctccgtcgaatgctggaaatacaatggtcctcgtccgacttgaggggcaaagtgagtttattcgagaaaaaaacgactaaaattgaacaaccgaaaatgatcaattgcaatgttttttgttttctagataaaaacatgctcgagtcacggattcagatggacacagtctaccaaaaacaacaggtgagaatttcaatattaaatgactctaaacgtaggtggtggtgaggtaatacatacacagtggtgctcacaattttatagctttctttttataaccttcttgaacagatatgaaaattccaatggtgtgattgtgcagcaattttttgaactgatatacaattttttaaaaattaacgaacgtcctaactaatctaatttcttgcatcatttttcaagagaaaagttaaaaatatttagtttagattttatgtttcgaaaatagattttcatgattaatcatttgaaaaaacccataataatcgtgagccgacttttaaatttcttttaaaactaaaattgagctcaatcaacccccctcttttaaaaatttaatgtttttcgaaattatttgtgtccagtttccagttaatagttttgcttgtttcctagaattttctttgctcttctccgtctcttttctgttgttccgacccgtaaagtgacacaatatggtcagtctgtgctattcctttcttcgttcctaatacatttctccccttgcatttttctcgttcccgagagtttcgtaagagatttatttcgcttttaaaatattttttaatattcaggaagaacgatctacttattttgttgctaagctatgatagtatagtcggtcgccgctacaaaaattttaaatttagtttcttctctttacattttttagttgctcatttacacagtaaagttttgctagaggattgcctatagctaatgatcgtcgactatctatgaaatgaacgaaaatattattttctaaacataagccgaacagaattcccacacggattattaatttg