Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F42A8.1   

sjj_F42A8.1 RNAi (2)
PCR_productsjj_F42A8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF42A8.1 Source_evidenceePCR607WS150 Sequence/Annotation Release
Overlaps_Gene F42A8.1 Source_evidenceePCR653WS150 Sequence/Annotation Release
Chunk_score Abs_score590
Max_abs_score590F42A8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII93414269343637
Overlaps_transcriptF42A8.1 Source_evidenceePCR653WS150 Sequence/Annotation Release
WB_DNA_textsjj_F42A8.12212ataacaagagaaagctcgctgtggtcacctagtcaaaacaacgtgattatttgccacgtggcaaatcgtacttaagtccagacgtattcctttccaactgtgccacatcgaagatcaccaactcggcaccgtcagcagtctttcggcaagcaagtccaactgatgaatccttttgttttggaagattccaaattgtgtactttcctggctcaaggaaaattcgatcgaatcccttgtatttatagatgcatccaactgtggtgacctttgtcttgttatctccgtcagtttcgcaggtcttctcgatcttccagtctgggttctgctcataccatctacatccgatcaccttgttaatgtcacgaccattttcaacaatcgagcatccgacggcacggtggcttcgttttcctggacggatctggaaattataagttgaatatttggatgtacatattatatttaatttccaagagtcagtagggatttagtttaaataaacttattatagttcaaaatgacaaaacatttcagatttttcaaaattttcagtcacagttttggtaaattaccaaatttatcaaaaattgtcaactgacaatatgcagattagtcctttttctacagttttgatgttatttacttttttgaaatatttgaaattaaccgagatatgagctgccaaagtagagattttcctaacgtctggattcatttcgggacacctaattcttagttccttaatgtatcattttcatatttgaaaacttcaatttcagaactgttccattgatctcccgttctattttttctcattctcatcaccttcttttgcatgtttcccaattacctcgttctcctctttctctttttcacattgaacgttcactgttgtatgtgttttgtaccctaacagtctaaacctattgtccagaaaaaaagcatccaataactgattcctgtccccactggtacagtcattgaccggaaacatacctcgcactgataagtggttccatctcttttgtaccgttgtccatcatacaagtcttgtccaccagcaacacatccgatgcactgcttcgtacactttccaccttgcaacttgcaatagaagaggtagtctccgtcctgaaaacgagaatatacaagttaataagaagatgatgttatctatttcatcaatctgttttttttctgttttttttcaaaacttatttttaaggtatgtacttcctattaggatttgttgttatcattttcatcttcagaacttttttttcgtgaaaagtttgatgttcaaaaatcgcaggattttgcaggggcacgcccttggacaagttgatttaatgttgatttgaacatgtttagaaggttcaaattgggtttggaagacttccgggagaaatgattgataatggatgaaatgaaattcaaaaaaaagagaaaagttctagaagtttcggcgccttcgttttttttcgtttcaaattactaggaaataattattttgacagatgcattgggcttggtagatcccgatcccagtaggcacaaaaatatctacctacatttcagaagacctacgccggcctatgaaaaaatataaataggtggtaggcgagtcatgaaggcttgtccacccaaactcattggtaaaactcactctgtattgttgtccaacagtgtatcgagttccctcatgaatacatccaacactgcacatttgaacgactccagtagttttttgttggcatttataactgaaaatattttttccatactcttcagaattcaaagtctcaacttaaaaaaaaaagttgctaccgcaaaagttcaagtatctcgtagacaccaaccgataagatataaaagagtgcattttcgtagtgacccgttttttttgtcactttatcacataatctcgccatatccgtcgcccttatcaatgaaaaaaaaaactaaaaaagttgttaaaatacaacttgggagaaaataggattacggtggatttgaaggttgcaggatatcaattaatttccaagtgctatgaaaacattgaaaggacataaaaacaggatttgaattatcatttttgatctttcatcaccgaaaatgtacccgagagtactgtaatttagattatgatacgttcgatagcactagtccacatgtcttatttcagaaaaacctacgcctacctcgtacctac