Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F42G8.5   

sjj_F42G8.5 RNAi JA:F42G8.5
[cgc5655]:F42G8.5
PCR_productsjj_F42G8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF42G8.5 Source_evidenceePCR716WS150 Sequence/Annotation Release
Overlaps_Gene F42G8.5 Source_evidenceePCR716WS150 Sequence/Annotation Release
Chunk_score Abs_score653
Max_abs_score653F42G8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV81377548138874
Overlaps_transcriptF42G8.5 Source_evidenceePCR716WS150 Sequence/Annotation Release
WB_DNA_textsjj_F42G8.51121aaatttcgtggctcgtcatcattgatttgttgtacagcattcggcgtttttctcctaattggaggactactaatgtcacttcttggatataaatacctttatacttcaccattctggacttggccatacgaacaaagaatacgaccaccaccaattcaaattgcgggtcctattttatttggactcggatgttcgtttttgataatttcattaatctactttttatgcacaacaaagctctgtgatctctcgttacaccacacaaagaagcacaatgatcctgctaggcttacgactattacaacacattatgtggtaagtctttttgattaattgaaaattcaaattcaattagaaacccacatgtccttgtaaaagttgcgactacacctttgaaaatttcatgaaagtaatataaacaattaaagctaacaaattaacgtctaaacaaactcaaaatgatcgtaccataatttaaaaaaaactattaaaacattttagatttctgaaaatggcatagttttggtaaattgccaaattaaccgaaacagcaatgtgtttgaaaccttacaaggcttagatacagttcactagaacgaagaatgtaggtaataatgcgtatcaattcaaaatcaaaatgtacccattttagttgttacacgtttacagccgctacctccgatctttgagaaagatccatatcaacctctacctccacctgcgtacccagttcttgagaatcgacacgcaatgtctaatgtagttaagccacacgatgaaaagaaactgtatccaccagtgtaagaacttcattcaaaccggaacaagattctgtaaatctataatttcagaattcctggatgttccacactttcccttcatagacgatctccgaataacatttttgtagcaagtccatataataccctaagagctacaagcgttggaagatatcaatctggattccttgacacgaattcaataatggaaaatcggttaggatcaaggcagccgtcagttgcaagtagaagacaatcaagtgaagcttcaagtcaaaaaagatccaaatcaatgggacctttacatcgaactaactccaatcgaagcaaaggatcaggaag