Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F43C1.2   

sjj_F43C1.2 RNAi (6)
PCR_productsjj_F43C1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43C1.2b Source_evidenceePCR815WS150 Sequence/Annotation Release
Overlaps_Gene F43C1.2 Source_evidenceePCR815WS150 Sequence/Annotation Release
Chunk_score Abs_score773
Max_abs_score773F43C1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII42173714218826
Overlaps_transcript F43C1.2b Source_evidenceePCR815WS150 Sequence/Annotation Release
F43C1.2a.1 Source_evidenceePCR815WS150 Sequence/Annotation Release
F43C1.2a.2 Source_evidenceePCR815WS150 Sequence/Annotation Release
WB_DNA_textsjj_F43C1.21456caggattctgccctccattattccttgcagccgcttctgcctccattcgtctgtgatgagcctcggcttcttcccaaatcagctccttcagcttctccttcggtaaatcgtcgaattccatttccaaagtgaatggttcctcacaaactggctcatctcctggatcgtagtattgctccaagtatgggtgagccaatgcttgctcgatgtcgatactgaaaatcgaaatcattatggattgttaaagcgaatatctatgtgaaacacttcaaaaaaatttctctgattatatattttagcttgaaatcgtgaagaatttaattttgtaactgtaaatagactaaaaactattttcaaactcgtgctagagaaattctcattagagcgcgctgcttgtttagatttacgagattttttaaaattgttctactattttccttaatttttgtcgggtgttttacttaaaaatgtgtttttttcgtgtcaattttattaacataaaattaaatttttttttcgaattgaaactcgacgaaaaattcggaaattctaccagtttttgataataaaaatttcacttttttacccggaaaaaactcgtacgtaaatcgacacagcccggtgcgctccaatgagaattttcaataaattctcaatatttcaagattaaattatcttaccgattatgtggattgaaagtgagcattttgtccaataaatcaagagctcttggatcagctcctggatagagccgagcccatggttgttttggtttgtgtggcaatgaaatgagatatgatcgagccttatcattaataatacattgtaaatcagcatttgacggggatccaacaactgccaaaatcaaattgagttgatccaaataatgttttcccgggaacaatggccgattactgagcatttctgcgagaatacatccgacagaccagacatcaatcgatttagtgtatccctttgaattgagcataatctctggagctctataccaacgagtagccacatactcggtcaagaacccagtatgatcggtttgtgggtcggtgacacgtgccaatccaaaatcgcaaattttgagatcacatgtggtgttgagcaacaaattcgatggtttcaaatcacgatggagcacatttgcagagtgaatgtatttgagaccacggagaatttgatagagaaagtagcaaacgtgatcatttgagagcttttgagttttcagcaatttgtacaaatcagtctccatcaggcattgaactatgtaactgaaaaaaaaacattatttgtaaaattcacttgaaaaagtagttttactctttgaaaagaaaataggggaaaaattacaacaattctcgattttttaaaagtatttttcggtcatttttcccctgtaaaagcggaaaatgaattttttcgaaaaatcctcacccctgaattgaac