Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F43D2.1   

sjj_F43D2.1 RNAi JA:F43D2.1
Simmer:F43D2.1
PCR_productsjj_F43D2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43D2.1 Source_evidenceePCR759WS150 Sequence/Annotation Release
Overlaps_Gene F43D2.1 Source_evidenceePCR759WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633F43D2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1461496114616645
Overlaps_transcriptF43D2.1 Source_evidenceePCR759WS150 Sequence/Annotation Release
WB_DNA_textsjj_F43D2.11685caattgcggacttgacattgcggacttttgcttaccgtgttttatcgaaaaaatgcatgccaattttaattttctaattctcgaatttcaatcaattcgttcgttttaactaaaattatactattttttcgggcaattttttttcaaaattcacaattcaatcaagtactctcacagatctcaaaaatgtccgattggatttggccgctggaggcgctaaaggcaaggacaccaaattctgttgtcgttttttaaatttttcactgttttttagacaacaccgtccatcagagctggtttaactaaagaacaagagcttctctggcgccgtgaaggtatcaagctgttatcggaagtcggaaatgccctcaactggtaaatataattttcgaaaaagtcgaaatttcaaaattcaattttgcagtaaaccgcgccccactatcggtgttgcagctgtatattttcatcggttttatatgattcacagtttccagtcattcagtcgagaggtttttataagtttaccaggcacaattaaaattacttttttcaggtaactgcactaagctgtttgtttttggctggaaaagtcgaagatttcccgaaaaaatgcaaagatgtttgtcaagcggctgtgactcattatccagaaatttattcaaagtaccagaaccttgtggtcagtaaagtgattcataaacttgataaattgaatatttcaggacgatgtaatggggctggaaagagtactgttgcacagtcttaaatttgacttgcatgttgctttgccgtacgatgctttgctggattataagatgatgtttccagatatgaatcgtgagaaggttagtaaaaaaaattatttttcaacaatcattacgtgttccgattttagaaattttttcgattacaaaattaaacacattttcagattaccgacgccgttcaaatagcttggacattcatcaacgacagcatctacaccacattgtgcattaccacggagccacaaatgattgcaatagcacttttacatcttgcgttcactgtaaaaggatatcagcctgttcagaagaatatggatccatgttggtggtcagcggatgttagtaattggcctcaagaatcagttgacaaggcatgtcatctggtgctagatttctacgctgctactaaagaaaaaccggttctggagaaaaagaagctcacaactttttagttttcaaaaatctaatatttctatattttcttgcttcttctgttccagattatttttgtacagaacacctaatcttggattgtgttgatctcttttaccaaataaatctgaacacttatttggtatttgtttacaaatcccctgggcaccaattcacaatcaattcgttccgtacaacgtcgtcgaaaccaatccttctcgaatttcggtgcgccgtgttcccacgcgaagagggaagaagagagaggttcgggggatggattactgacgacgtgatgacggagagatgactataataacacaaaaaagaatcagcagtctttatgtcttttctttttattcttctttttgttcccctttacttttacttcttcttcttctgtttgcattaacacgtcacctgaataattgtgaagagaagtttcagaagccgtttaagatagaagaagacaactccgtgtcggac