Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44F1.1   

sjj_F44F1.1RNAiJA:F44F1.1
PCR_productsjj_F44F1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_GeneF44F1.1 Chunk_score Abs_score438
Max_abs_score438F44F1.1
Specificity_index1
Rel_score1
Overlaps_pseudogene F44F1.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Map_statusUnique_ePCRI1325176213252711
WB_DNA_textsjj_F44F1.1950ttggaaggaatgattcgaggatctttctggatttcgtgggatgactttttaactatgtttacttttattcatgtttgtcgttatcgttcgaattggtttgcatattatgccaaagtgtttcttaaatatccacgtggttacacgttcccggtaatcaaaatcaatgtcccggaaaagtgcacaatctgtatttcggcggtggacgactggatttctcgtgtggtacgcttaaaaactattgaacatgcttttcagagatattttttagaagtctagctggattacggtgcacatggatgacaaaaactatgaatcggatattaaaaaagttgttgcgtgtgagatcattgatgattcaactggggatattgatttggaacctggtagctacgttattacagtgaataaactgaacaactcgcccataggcaaacgagatatctcaattcactcttcccgaccaatttcggtcaatgaagggtttttggtaacaagtgaagatggtgaacatataaaatatgtagtggataagtttggacaggaaattgtgaaagagccggtaatgtttaaaaaaaagtcagtgaaacaatatataatcttctttaatattcagaaggataaaatgagcattaaaaagtacactgataataattccacatttatcgctgtagttgcatggaacttcgcatatgatcagtttctacatgttcagtaagtccaatttttattttagatatacgttgtgcttttgtcctttccagtttgcgttactcaatcaccgatgaacaattggtctctagaagtttagaagacaatcaaacagttgatgttattcctccaaggggtgttcaggtaactttttttcagtatcacattcatcatgtagatgaaattgtagattttggtagtaatcgaacaatatgcaatgccggagattgtggatttcccaa