Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44F4.11   

sjj_F44F4.11 RNAi (3)
PCR_productsjj_F44F4.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F4.11 Source_evidenceePCR930WS150 Sequence/Annotation Release
Overlaps_Gene F44F4.11 Source_evidenceePCR942WS150 Sequence/Annotation Release
Chunk_score Abs_score900
Max_abs_score900F44F4.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1091844410919613
Overlaps_transcriptF44F4.11 Source_evidenceePCR942WS150 Sequence/Annotation Release
WB_DNA_textsjj_F44F4.111170ggcgcaacactatttccctatttcttcatagttcttcttggcctcgccgctgaccactattgtccttctcttctccccgtagtatacataacgcccgtatatctttgcgttcctacgttctacgattttatagttaattttactattctgaacctaaatttctttcaattttcagagaaaaaaaaccatgcgtgaggtaatctccattcacgttggacaggcgggagttcaaattggaaatgcttgctgggaactatactgtctcgagcacggaattcaacccgatggaactatgccttctgagcaacaaaatgagggtggatccttcaccacgttcttctcagatactggaaatggacgctatgttccgagatctatttttgtggatcttgagccaacagtcgtcgacgagatccgcactggaaactacaagaagctgttccatccagaacaaatgatcactgggaaggaagacgctgctaataactatgctcgtggtcactacaccgttggcaaggagctcatcgacactactcttgacagaatccgtcgtctcgccgacaactgtagtggtcttcaaggattctttgtcttccactccttcggtggaggtactggatccggattcacctcactgctgatggaacgtttgtcggttgactacggaaagaagtcgaaactagagttttcaatctatccagctccacaagtttccactgcagtcgttgagccatacaactcgatccttactactcatactactttggagcactccgattgtgcattcatggttgataacgaggcgatctacgacatttgcaagcgaaatttggatgttgaccgaccgagttacaccaatctcaacagaattatctctcaggtttcgcaaaatacttgttttaatgtatcctatgtgtttccttttcttttcaggttgtgtcttcaatcaccgcttcactcagatttgacggagctctcaacgtggatctcaacgagttccagaccaacttggtgccatacccaagaattcatttcccattggcctcttacactccattgatctctgccgagaaggcatatcacgaggctctgtctgtcaatgacatcaccaatagctgcttcgaaccagcaaatcagatggtcaaatgtgatccacgcaacggaaagtac