Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F44F4.11_b   

sjj_F44F4.11_bSequenceGTACTTTCCGTTGCGTGGAT
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_F44F4.11