Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45E1.6   

sjj_F45E1.6 RNAi (2)
PCR_productsjj_F45E1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F45E1.6 Source_evidenceePCR592WS150 Sequence/Annotation Release
Chunk_score Abs_score550
Max_abs_score550F45E1.6
Specificity_index0.869
Rel_score1
Map_statusUnique_ePCRX79809547982089
F08G2.3 Chunk_score Abs_score79
Specificity_index0.131
Rel_score0.15
Overlaps_transcript F45E1.6.1 Source_evidenceePCR592WS150 Sequence/Annotation Release
F45E1.6.2 Source_evidenceePCR591WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45E1.61136ttgacaaaatttcaaaacatcccgttgcgaagctttaactttttggggcatttttttgcttaaaagagtaaactaccagattttgctattccaccaaaaacatggcatgttttcaagataaaagtaacctggtccagttctaaaaattcagaatcaactttcaaaaaacgttcaaaaatatctatttgaaggaattatgtctgagtcggaatttgttggcgcgctttatagttgttagcctctttcggtatcttcaaagatttcaattcctgattttcatcaagatttcaattatttctatttattctcaacgatttgataaataaatatgtttaatcccaactcatgcacgctgttcaaaaacaaggaaacacaaaatatttacgtttattacttttttgtaaaaaaaataacatagaataacatgcactctcggctagaataaaagagagattaagttaagagatggaagattttagtacattgagagatacataatagattattcagagagattggcgaaacagctcaacgtttatgcacgttctccacggatgcgtcgagcaagctggatgtcctttggcatgatggtgacacgtttggcgtggattgcgcacaagttggtgtcttcgaagagcccaacgaggtaggcctcagaagcctcttgcagagctccgatggcggcggattggaaacggagatcggtcttgaaatcttgagctagaataaaaacagttgattaattaataaagaacattacaataaatattaccgatttcacgaacaagacgttggaatggaagcttgcggatgagaagctcggtggacttttggtaacgacgaatctcacgaagagcgacggttcctggacgataacgatgtggtttcttgacacctccggtagttggagctgacttgcgagccgcctgcaattatttcttcgataaaaaataatatttcataatgacaaaccttagtggccagctgcttgcgaggagcttttcctccagttgatttacgcgcggtttgcttggtacgagccatttcaattctggttcacctgaaaattatacgcaatattgataatagaagtcagcatcaaaatatatggaaaatgagatgactaagagcaagcg