Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45E12.3   

sjj_F45E12.3 RNAi (3)
PCR_productsjj_F45E12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45E12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
Overlaps_Gene F45E12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score Abs_score864
Max_abs_score864F45E12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII73024527303626
Overlaps_transcriptF45E12.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45E12.31175attttgatttccagcgaacgcgaatcaaaatgatgttgcgatgggggacaccaatattgatagtaagtttattcttcgataggtgttatattttgtttgatatccaggtacagacggatcagttggtagagattgggctgttctttcggataatgttttcgctattcttgaagataggaaaacagtaaccactttggaaggcttattcagcgtaagtttttgattgtttaaaacattgtaaaaactgagcgttttcagaaggtcagatctgtgtgcgataaaaatcaatcaaaagtactttacgatcgtctcgttgcaattgttgttcagtttgcaaaatcattaaaggagtcgttaaatgcggttgagcaagttcctcttgcagaagacaattgtgagcaatatttggaaaagtttgggcagatctggcaagcatatccagttaaaatcgtaagtgaagagttttatttaaaaaaaaacaatagatttaactcagaatctcatcaggaatatttttcttcatctggaccgaattgcgctcggcgctacagacacagaaattctccctttgtgggaatgtttcatgcaaatatttcaaaaaacattcttcccgaacattttcaaggaattcaaagcaacaaaactgttcaatgctctctatatggcgatgcagaaaattatgcagaggtatccagtggacagtcctctcagaagtcttgtagatatgcttcaaacagttcatgtgtctgaagaatttgcaaaattccttattagccaacttcgagagcactataacaatgagagaatcgataaagttccaaaaatgaatgtaggtttttattttcattctttgaaaaatctcgattacttatatttattttagtgcaacgattacatggaatactgtgaagaccagataaatcgatattcgcaattagtgaaagtgaactttgatgaaccgtcggctctaaaagatgttcaggcaacagtgacaaactgtctcattcaacaagcaattcctgaaattctcacacatgattttgacgatcttatcgattctgataacatttcggatatcggccgaatgtttaatttgtgccgtcaatgcgttggtggagaggatgaagtacgtacacaattctcaaagtatttgaaaaaacgcggagagaaattga