Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45F2.3   

sjj_F45F2.3RNAiSimmer:F45F2.3
PCR_productsjj_F45F2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45F2.3 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptF45F2.3 Source_evidenceePCR379WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45F2.3674caattggaatccgatagagactgtgaagaaaggagacatgtacactgcatttatacaaggttgtggtggagaggcggggaggtgagagagtgggtgagagtgagtgagtacaaagataacaagacaaatgtgtccccgcagtgtctcctccttcacaccgcaaagtggtataaaaggggcagccaactgtccatttcttcatctcacttgtgagtcttcattcaattgcaaacaatgtccggacgtggaaagggaggaaaaggcctcggaaaaggaggtgccaagcgccatcgcaaggtccttcgtgacaacatccaaggaatcaccaagccagctattcgccgtctcgctcgtcgtggtggagtcaagcgtatttctggactcatctacgaggaaactcgtggagttctcaaggtgttcctcgagaacgtcatccgtgatgccgtcacctactgtgagcacgccaagagaaagactgtcaccgccatggacgtcgtctatgctttgaagcgtcaaggaagaactctgtacggattcggaggataattttatctctcgatttcatacaacaaaccaaccgaacccaacggccctctttagggccacaaatgcaatgtaatccagttttatttaatgaatattttttactattctttgccattttattttcagga