Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F45H11.4   

sjj_F45H11.4RNAiJA:F45H11.4
PCR_productsjj_F45H11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45H11.4 Source_evidenceePCR758WS150 Sequence/Annotation Release
Overlaps_Gene F45H11.4 Source_evidenceePCR758WS150 Sequence/Annotation Release
Chunk_score Abs_score674
Max_abs_score674F45H11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1038637710387567
Overlaps_transcriptF45H11.4 Source_evidenceePCR758WS150 Sequence/Annotation Release
WB_DNA_textsjj_F45H11.41191gagccacagatgcggataatgaataggagaagctcatcactaatgccttgtgagttgttcccatgtgaagtactagaaatgcaatccagacaactactgtgcagtacctgaaataattaaataaaataggaatttattagataaaataactgaaaaatgataacatgttccttttgaaaaaatggtaatgactttgctggctgagaactaaagacaactacagtttaaattttgaaattgcaaaaaaaacttacatagtaaatccaatgaactttgcctcgttaaagttctccggaagatttcttgttttgaatgcatatagtgtgcacaaagtaatcagaaaaaagtcccaaaagaatggaattagaaatgattttgtttcagtgtcacattctaatatcaactttcttggcaatgcgtacttggcatacgtggcatccggccaatcccgcatcaaaccaactccgacgatcacacattgaactgctacaaggatccaggttatcactacctgaaattggaacatttatttaaagcgagttgacttctctgaatatttattccaaaagaatgagggcaaagcctttggagcattatgaaaaaagttattgaacaattttcaaaaacttatcacacatgtcagttattaggaattgagtttcgcatggcacattattatttcaacctaatcaaacaataacttgtcaaatgagaaatgcctcattctagataattttcaaaagttcatactgtttccaaataaaaacatgaagctcgttcccagatactttattcgattttcatcataatttataatatattttttcaatttctctaaggttccaagttctcacctgagaaaatgtagtcaaaaaccgtggtttctttgtcaatattcgctttttacttccagctaatatcctcgctattcgatttgtctttgtaagtaaagccgaatatacaacagcaaatgcaattggtggtataactcttgtgatgaagcatgaagttgttgatggagttgcaagtaatgcaaatgatacagcataacacgcaacaagaccagataaaatgatatatgacagttctcttgttgtactcttcacaactggtgttgagttgtgacgaaggaatacagcaagagttgccatacttgtaatgattccagttactgctagaacaagggccaag