Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F46A8.6   

sjj_F46A8.6RNAiJA:F46A8.6
PCR_productsjj_F46A8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF46A8.6 Source_evidenceePCR416WS150 Sequence/Annotation Release
Overlaps_Gene F46A8.6 Source_evidenceePCR416WS150 Sequence/Annotation Release
Chunk_score Abs_score363
Max_abs_score363F46A8.6
Specificity_index0.649
Rel_score1
Map_statusUnique_ePCRI1124404811245172
Y22D7AR.1 Chunk_score Abs_score74
Specificity_index0.132
Rel_score0.204
F49F1.12 Chunk_score Abs_score122
Specificity_index0.218
Rel_score0.336
Overlaps_transcriptF46A8.6 Source_evidenceePCR416WS150 Sequence/Annotation Release
WB_DNA_textsjj_F46A8.61125ggggaaatttgattttctgtaggattttgggaaaactcactgagccgtttgatccggctgctcactacgttcctgaaaatgaaatttgggtgcagagatcgtaaatgaacaacagcttttgctcacttttttgggttaagctaggctttggcttaggctgaagcttaggctttggcttaggcttgaacataggcttatgcctaggcttaggcttggggttaggcttaggctcatgcttaggcttaggcttaggctccggcttgggctgaggctgaggcttaggcttaggctaaagccttgacatagtctcaggcttgggcttaggctaaagcttaggtgtaggcttaggctccggcttgggctgaggctgaggcttaggcttaggcgttggcgtaggtttaggcttagcctttggcttaggcctaatcctagtcttaggctaaggctcaggtttaggcttaggctcaggcttaggcttaggcttaggcttaagattctaaggccaaaaactcaccgctgatctctgcgtggacttgacatccgggtccattggtgccaccacctccggcttcttcttctccgccgacttcttcgatttgctcgacttcttcttcttcttcgagaccttctgcgaagaatccgccgatttcttcttcttcttggctggctccttgctcttcttcttcttgctctttttctgattgtccatcgctgtccgcgtgctgtccggccccacatcagatacctgcgcctgaaaaaatacggtttcagaggctgcaaactacaaaattagagtcacctctctcatcgacatcgtcattggtcgcacaggacactggctcttaggaggcttcttcttgcaaaagcacatgaccaggattccactctgaaagtagtttgtagtaattgtagttttgtagtttttgtagcagcttaccgttatcattatgaatatgttgtagataaatagtgaatcgatacactccgccatcagttgatttgtttaataagcaggtagtgttattgggaaatgattacaattgattatagattcgattttttgattatcgatttatttggaaaatttgaagtaaacaacaaaaaaatagacacgtggttggtcac