Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F46C5.9_b   

sjj_F46C5.9_bSequenceTCTGATCGGGGGATTAGTTG
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_F46C5.9