Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F46G11.3   

sjj_F46G11.3 RNAi (15)
PCR_productsjj_F46G11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF46G11.3 Source_evidenceePCR946WS150 Sequence/Annotation Release
Overlaps_Gene F46G11.3 Source_evidenceePCR946WS150 Sequence/Annotation Release
Chunk_score Abs_score858
Max_abs_score858F46G11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX57842635785409
Overlaps_transcriptF46G11.3 Source_evidenceePCR946WS150 Sequence/Annotation Release
WB_DNA_textsjj_F46G11.31147aatggttggtctttcgttgctgattttagctaaaactatttttcaggaaaactaaaactatgcgattttggaagtgctacaacaaagtccatcgagatggcaccactatcaaattccgaaagattagcggttcaggaagaggtcattccgaaataaattttaaatgaaattgaaatctaattttcagatgttcaaatacacaacacctatcacccgatccccagaagtttgtgatgtctactcaaattggcctatcggaaaacaacaagacaactgggcaatggggtgtttgatctattttgttgcgtttggagagcatccatttgatggatcagcgctggcaattatcaacggaaagtacaagaagccaccaccggttcagcaaaaccagttatcagcgtttgcagatttaattggtaaggagttttctgctgggcgtaaaaataataaataaagaaatataaacccaacttacagcaaagtgtctgacacccaatccggatgaacgaattactgctgcaaaaattgaggaatacatgaaactagcaatgcagaaacaaccaaaactagctgcaaaaactgatttcacggatatactcgatctgatgaatgttcaaccggtacaagcggagcaaagtatcgaatcgcaagctgcaaaaggattctttacaatgcaggacaaactattttccaatttgacatcactcaaaaatacagttgtacagcagacgaataaaatgggatggggaatggagccaacaaatactacaccacgccccgggcacccttcaacatctccgaagcttgtgccaaaaacacatagatcaaatcaacagcaagagagtgagtgaatgaattgattgaaacttctctaatgccagtatattttcagaaaacgcaccaccgagaccacccacaacagcaagccctcgtgcagccccagttgcaacattcaaagtttcatggccgactgatagttctcagaatgattctgcaaacgattggggagactttagtcaagcaccgccagcggtgaatgtttcgaaaaaagacgtattcgatccgtttagcgagtcagcatcacacaatttgtctgcaaaacatagcgaagatctgttatccttacagaattggccaggaactggta