Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47F6.5   

sjj_F47F6.5 RNAi JA:F47F6.5
Simmer:F47F6.5:Repeat_a
Simmer:F47F6.5:Screen
PCR_productsjj_F47F6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF47F6.5 Source_evidenceePCR950WS150 Sequence/Annotation Release
Overlaps_Gene F47F6.5 Source_evidenceePCR950WS150 Sequence/Annotation Release
Chunk_score Abs_score866
Max_abs_score866F47F6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII12565221257614
Overlaps_transcriptF47F6.5 Source_evidenceePCR950WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47F6.51093gtgcagaagatcactggcaaatccacggaaagtgctaccgacttcacaacggaaagtacacttgggcccaggccaaggctatctgtcagacgggggttggagatgatgtcaaatctcaagtcgcaatattctattcggaggccttgagcatctacttgaacgatatggagaacatcggtgctgcctgggtgaatgttccgaacctcaacgactacttcacgaatcctaacaatgatcatggtggagtgtacattcaaggtgcagcttacaagtatgacactcgtcagggaagtattatgatgttcaaagctgagtcgaagcatcaagtgatctgtgagtacacacctccaacgacaatggctgagatgttccatctggcgaaggtctacgcacagatctacccgatcggagtgtactctcatggagccgtgttcccgacaagtagctatgtcaggtaatattttgaatatctctgctgccttaccatcttaattttcagaatcacccaaactgacatcatcgcttacaatggaaagttcacggataagtacggaaacgaagtggagaagtttgatgcaagtggcctcgagaagaagtgtgcaagcatcggaaatattctgaatgtgaagagctatccagtgtccggtcacgctgatgatttcaatgctatgaagagtctgctcaagggtcatcaatgctatttgacgagttcttacaagaatgagttagttacctatctgtcgagttttcttcaaaattataaaagtttccagtggtttcaagaaaacggactaccgagcaaagagcggcaataacagcttggaggggggaatcttcgagggagcatcttccgatgagtactgtaacgcacatagtctcagtatgagtacaaccgaacgacttccgacgatggctgctacaggagcatgtgcgctctgtgcaatgcgtatgttctagacatgggtctataaactcaaatggactgtaatttcagaccagattcattatgagtacgggccatgtcctgataagccagattggattgacgaggtgtatcgtttcgagcggccgtctcgcgtcttttgtcattacg