Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F47G4.6   

sjj_F47G4.6RNAiJA:F47G4.6
PCR_productsjj_F47G4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF47G4.6 Source_evidenceePCR288WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptF47G4.6 Source_evidenceePCR288WS150 Sequence/Annotation Release
WB_DNA_textsjj_F47G4.61343atcctcagttttcctcacacaaacttgaaattttcggttccaaaatgtccataaacgtcgatgaattccaatgctaccgtattccaaacgtctacgtccaatggtacgatctggagccaacaattcattggttgaccggtggaaattcaaattcgcggcaaattcaggagatggaccagaagaagaaaaagatacggtaggtgggaagctaccgtaagtatgaactacagaaaccctacttataacttgcagtatccttaagctacagtagccctaagctacagcaaccctgagctacagtactcttaacctaactctgagctaccgtaacgttaatctatttacagcgccgctgaactattgtatcccatacgctacagtaccttaaactacagtaactctaagcaagagaaactctgaactaccgtaccactaagctaccgtactcataagctacagagtgtagcctacagtacctttagcctctattgaaactgagccaccgcatccctaagctacagaaaacaaaaaatagtcacagtacttttgtcctacagtgatatgagactacagtacccctacgcaatagaacccctaatctaattacagtaaccctattgcagtaatctatgctaaggtatttctaagctaccgtaaccctgtgatgcattgatcctagtctacagtaatccttagctactgtaaccctaaactacagcaccctgagctacagtaaccttagctccgatttccagctcaacatccgcctacgcgctattcttccgggaacggcagtcgctggagaaacgggccgcgccatacgccacctttggtcagatctcacagaaaatcgcccggcaatgggactcgctgaccgaggaggagaagaaggtaagtaccaggggtgtgcggcaaatttgccgaatttgccgtttgccgagctcggcaaatttcgaaatttgccgcacacgtcaaaaaattgactgtgcaattttgaccaaaaccattgatttttttgccaaaaatttagtaaaatgacacaaaattgagctattttgatgcttaagcaaacatactacactgaacttattcagaaaccagatgagtgttaagaattcagtagttttggtgctccaaaaaacatcaaaaaaatatcaaatttttccgagtttgttaagcacggcaaatttgccgaattcgctgtgctcggcaaatattgaaaaaagagatttgccgaatttgccgagctcggcagattttgagatttgccgcacacccctggtaagtacccccagctagatctagctcctggagcccagcgctcaacatttttcaatttccag