Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F48A9.3   

sjj_F48A9.3RNAiJA:F48A9.3
PCR_productsjj_F48A9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF48A9.3 Source_evidenceePCR741WS150 Sequence/Annotation Release
Overlaps_Gene F48A9.3 Source_evidenceePCR741WS150 Sequence/Annotation Release
Chunk_score Abs_score636
Max_abs_score636F48A9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI65857916587331
Overlaps_transcriptF48A9.3 Source_evidenceePCR741WS150 Sequence/Annotation Release
WB_DNA_textsjj_F48A9.31541tcaacacctacaccaatgtcaagaacatagatgaaacttggtcgaagcattgttctggaacacttacatctccacgtcatattctaacagcaactcattgtgcagcaacatatactgaaactgaatggaatggaacagttatagatgcgccaatttatagaaaatattgtgaggaacagaggtatgattatgtctacaatttgaaattagtaatgtattttcaaaaaaaaaagaatctgatctgcaccgggcaaaaatacaaaaaaacgaaaacaaacacttcagaataagctttgttctcggttaacagtttgtggaatattatatggacgcagaaaaatgacccttccgaaaccgacgttgaaatgcgctccacggctaattgaaaacgttccgcccccgaaccaggggtctcgttaggtatttggcggcgaaccctaagttcaagcgtgtgtgttgttttttccatagttattaatgatttctacattgcaatgatgtttaaaatgcatgaaaatttgcaaattaaaaaaagtgaaaatatttgagtttacggattcaccgcctaatatctaacaagacttactgttcgggaacgggccttttctattggccatgaatatcaaaatcgtgattctattcaatttcagcacgttgattgtaagagaagtggcggctagcagaattgtagttcgtttacgaaatcgaacagagatcggaagggcaaaatatgtaagagtatttgcagactaatctttaacattttttttttgaatattaaagttgttcatgttcaattactgtcgaaaaatagtggataagaatgcgtatgaaatacagtacccggatgacataatgattattgaattatctgaagatgttgaatacagttccgaattgaagccagtttgtgttgctggcaagtttcacaaatcagtgtttatcaagttgtttaacaacaataatttaggcagtacagatgacaatgctccaaatagtcatttggatcttttcggatttggagatgatcgtaagttataatcatgttagaaataaaggaacaacaaatttcactccatatattgaaatttgaacatacctgatttcaaccgatttcctgacttacgaaattgagagggtatacttgtagtcaatttttcgtttcagttgtttaaaactttgaaaattgtaaatgaataatttttgcagctcctcgtgataaaccatcgtccttaaagaatttgcatgatattccgctcaaacatcataaagtggaggtgaacatttattttagccgtgaataaaattatatatcataaaaattcacaagcgaacatatatttttcagataatggatatgaacaaggaaggaacatcaaaacgaatggatcctcgactttttatagcgaaaagtgtgactagaacatctgttgcatgtccaggagatagtggtgctggtggagttaaggaaattgacaaaaggacgacagttgttggagtatttactaaaagtactgttttcctttttcgcagaaacatta