Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F48C1.3   

sjj_F48C1.3RNAiJA:F48C1.3
PCR_productsjj_F48C1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF48C1.3 Source_evidenceePCR204WS150 Sequence/Annotation Release
Overlaps_Gene F48C1.3 Source_evidenceePCR204WS150 Sequence/Annotation Release
Chunk_score Abs_score162
Max_abs_score162F48C1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI53142245315752
Overlaps_transcriptF48C1.3 Source_evidenceePCR204WS150 Sequence/Annotation Release
WB_DNA_textsjj_F48C1.31529taattcgaaagaaaaatgcaacgaaaacaaccacaaaagtttgaaatggctaccataaactttttcgcgcgccgagacccatcttaataaatccgtgcgtgcgccttaaaaaatgcatctcaaaatttataggaaaattactataattttaaacactttcaaagcagtttgtattggtaaaatggagaaaaaataattttgtattttttacgcctcatatttgaaaataaaatgttaaaatttcagatatttctatatttggattatatttaacttctaaaggccgtcttttttttgaaaataaaatcaataattctgagaatttaagtgaaaattcaaaattggcggttctgggatcaaaattgatggagcactgtacttcctgaaatagagaactcttatcacctactattctctatcacccaattgatgatcataaccatgaacctcttattatcaaacatagtcataatacggcgcaacaaaaatacaaaaggggaggctgaacaacaacaaaaaaacgagaacgaccctggtgatgagtgatcacaagacagtgaagagacgcagaggcggaagaaagaaaaatgaatatgaacttgaaacagacacacaatgcttatggtgtgggaaaatgaacggaaaggaaaaaaaaagaaatgatgaagaaagaaagaaaaactttttgtttatcactctgcgtttcgtctatgattttttgggtggcactttttgatttgattttagaaattgaaagagcttaatagagttgctaggaaactaccgtatgacttccatattaataattatttattcatttttaggtataccggatttgaatagtttttgaacattctatttttaaaaaagtaaagaaaatgttcgattgaaatataaaatgttatacagctttttttctaacttaaaattttttattttttcgaaatgaattttaaacttaattttaaggtacagcgaatttagtattcgaacatttatttcaaaaatttttttaacgttagatttttatataaatttttggtttctatacaaaatataatttttgactgaacttaaaattcctctattcaatttttttacattcaacaaatttgttttattcgaatatttcagcgggaaactataattttaatgatttttcgaaaaataggaaacaagttatttgaaatgtgaaaagtgtatggtatataattgttagatgagcgaatcaactgaatagtatcgcaaaaatttcgaatttcgctcgtttttacagaatttgagtgagaaaatatattatttcttcgaatttcctcgactatttaaatattgaataaagcattttgttttttgttatagttttcttacaaccaccaaaaaatttattcgcagaaataatgaagatttgaaaatcgattaataattttaaaaaaaaactcagaacaattctaagaaaaagagcgaaacaaaaaaaaagaaaaaaatgttcgttttgttcaacataagggtgtcaggtttcaagagttgac