Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49B2.1   

sjj_F49B2.1RNAiJA:F49B2.1
PCR_productsjj_F49B2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF49B2.1 Source_evidenceePCR917WS150 Sequence/Annotation Release
Overlaps_Gene F49B2.1 Source_evidenceePCR917WS150 Sequence/Annotation Release
Chunk_score Abs_score875
Max_abs_score875F49B2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1429871514299867
Overlaps_transcriptF49B2.1 Source_evidenceePCR917WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49B2.11153cccttctagctcatttcccctctcatggctctcccaattcttcgtcttccccgaaaatgcctacgtctcgcagctctgcacatgaaatttatcgatttgtaagttgcatttttcttggattttcttttttgttgagttttaaaaacttaaaaaccgtattttttgtagaatacgcttctcattcacctgtgagactgcaaaaaatctcgcggaaactttcaactttccggtgaccggaattcgaatggctatcagagcaaatttccgtcttgatgttatctatgaaggggaaatgtatacatttgcaactgagaagtggctggaagaacaggatctggaacaagtttacatttctcgacggcaaatcgtgattttcccggaagaatttggcatcagaaattacattgatcacctgcaaattgtgctgaaatatcctaagattactgagctgttcattgcaagcttcgatcacgattcagagcagttttgtaaggagtttgaaggcttgaagttcagaaccttaagttttggatccaacgatccactgtcctcaatgcgcaccgcaatcagtctatcccctcaaagtgatattatccagctcgaaggtgaagatatgtcatctgcgaagtctcttcttctacagaacaccgatgaagtctacataacatcctcaccattcacctttaccctcaatgacctactactttgcaatagccggagagtggttgtgcgcgcgagatgggacctgaaggacctgaacacgttcctgaagcactgggcagcaggggtaaggagattggaaaagctagttgttgggcatcagaatctaccgagaactttgaatcagcggatggctagcttgttccaagggatcagtcatgaggttttgccgaaggatcgtgtgacaaggcatttggatggtggagaggaagtgatgttcaagggaggaacgattattaggagaaacgatggaattgaggcaattgttatttttagttttacctttcaaatgtttgtgcttaatgatttatgaataaattttaatttggatttgtttgaaagctggaaacagaaaaaaaggttcctaaacaggcctttcagattttcaggttgatattcggcccggcagcctggcttttgccattttgttggt