Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49C12.11   

sjj_F49C12.11 RNAi JA:F49C12.11
Simmer:F49C12.11
PCR_productsjj_F49C12.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F49C12.11 Source_evidenceePCR388WS150 Sequence/Annotation Release
Chunk_score Abs_score304
Max_abs_score304F49C12.11
Specificity_index0.615
Rel_score1
Map_statusBest_ePCRIV93193439320309
F49C12.12 Source_evidenceePCR211WS150 Sequence/Annotation Release
Chunk_score Abs_score190
Specificity_index0.385
Rel_score0.625
Map_statusTop50_percentile_ePCRIV93193439320309
Overlaps_transcript F49C12.12.1 Source_evidenceePCR208WS150 Sequence/Annotation Release
F49C12.11.2 Source_evidenceePCR388WS150 Sequence/Annotation Release
F49C12.12.2 Source_evidenceePCR211WS150 Sequence/Annotation Release
F49C12.11.1 Source_evidenceePCR388WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49C12.11967aaactcaatttcagccaatcatcatcatgtccggacgtcaaggaggaaaggcaaagccactgaaggccgcaaaaaaaacggagaaggatctttctgaggtgaaaatgatgatgatactagatattttatacttatcatgggcgtaatattgcaaaaaaaaactaattgattaatgagagaagaaatccaatagatcagtttttcgttcaatattgtcacacttttgagcgtaggttgatgaaaacgataatctcatataattttttgaacacttatcaagaaatcatgatacttggaggcgccatggttccgtacaccgaataggattttaaattttgaatgagttgttaatataaatagtcatttgaaacggtcatagtgagaatttttgatccgaaaaatgtataataatttcatggttacaggaagacgtcgagttcaagaagaagcaacaagaggaagccaaaaagatcaaggagatggcagccaaggctggacaacgtggaccacttcgtaagttatttgttaacagtaaaataacattaaactatcaacctgttttgcagtcggtggaggaatcaagaaatcaggaaagaagtaattgcctcggtcaaatattatgccatctcatccgcaacctctgttattaattcgtcaaatgactcgttatttcatccatttccgttccatattttacatattcttcgttccgttctgctcattccctttttgataatttcaacatcactatatttctacgaatgaattgttatctgagaatatcaatcatagaaggcgaaaatattcatcactaaaattgatttggaagactttagaaacatatacaggaaaatgaactgatggaatgtcggatgggactcttatgctacagaatacaattatatgggtggaaatgagcacgtctctaaaagcagagacgattttaagggggaaattcgaaaaatta