Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49C12.12   

sjj_F49C12.12 RNAi JA:F49C12.12
Simmer:F49C12.12
PCR_productsjj_F49C12.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F49C12.12 Source_evidenceePCR376WS150 Sequence/Annotation Release
Chunk_score Abs_score313
Max_abs_score313F49C12.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV93202879321392
Overlaps_transcript F49C12.12.1 Source_evidenceePCR376WS150 Sequence/Annotation Release
F49C12.12.2 Source_evidenceePCR374WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49C12.121106taagggggaaattcgaaaaattatggatcgcgagagaatcaggatacgacgatgtgaacaattgatgcagatatagaaggctcaaaagatttgtgccgtgttgtatttattctgccaaaagactgcaataagagtaactgcatagagtccggctgcaatccaacattgtgttgctttctcgttatattttgcgtcgattacactgaaaaaaagtttaaggaaatttttattttatatttgaagtaatattgatcagctgttttttctttaaaaactatttcgaaatttctttcagcaacactggaagatatttactgattttcaataaaatcaagctattgatgatttttttcaagtatttagcacttatgagcagactacatgacactcgtttagaactatataaatatttgtttggtgtttattgagataagcttcgtaaacatttttattttgatgtcggtagtattttaagacaagacttgagattttcgaaaactcataacagttgtattaaatattttaatgtttttctacaattcaaaatctcacctcgatggaacctttccgtgtccttcgaaatgaagatctgggaagagagtgacggcttgaatgtagaagaaaacaccgagaaggcccaggaaaattactccccacaccgacatgaccatgctgaaaatatataaaagattataaattcaatactgtggaaattgtaaacaacgcaccagaaagccgacatttttggtcccatcagcggacagattttgcccattttatctgaaattattgatattatattttttaatcaagaaggaacacagagttaaagaataaaatgtttcaatcgatgaaatataatgataaaaacatagaaaagagcatttttagttcaaaacgaatcgatatttgcaaaaaaggagcgaggagcgtaaaattggtttttggtcgtgacgcacattacgcaactaatttcgcaacacgcactacttttcagaatgaaaaaattcaagataaatttataattttctctatttttttgctcaatgttaatttttatttcaaaatatttgttcaaaaaactgttgagtaatggacggaagttt