Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F49C5.6   

sjj_F49C5.6 RNAi (5)
PCR_productsjj_F49C5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF49C5.6 Source_evidenceePCR949WS150 Sequence/Annotation Release
Overlaps_Gene F49C5.6 Source_evidenceePCR949WS150 Sequence/Annotation Release
Chunk_score Abs_score823
Max_abs_score823F49C5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1256414112565819
Overlaps_transcriptF49C5.6 Source_evidenceePCR949WS150 Sequence/Annotation Release
WB_DNA_textsjj_F49C5.61679ttgcgtatcccttgtcatcaacagtttcctgattttcatgattcttacaaaatccccaaaacaacttggcgcctaccgttacttgatgatctacatttccgtttttgaaatgttctattccatcatcgacctggtgatcgatccagtaagtagaacgtcacaaattctcaaagaaattataatcatagcaacactattcgcatggtccaacattcctggtgatcgttgagattaaggacaaacttttgcctcctgcaggtctcactgtgctcaatacgttctactggggctgctttggcgcatcgatggcggtttttgccgtgcattttgtgtatcgttggcttgttgtaaccgagtaagcataaaataatgaattttggctttgccaaaagttcattaagtattataaaatgtctcattacaccgttaaaaatcgacaattttgaacaaaatttatttgattaaaaactaatctcattataatatcacaatttttgcgattttgtcgtaaacttttgatttctgaacaaaataattttcatacatcggcttctggaaacattcaacggctggagaatctggttttggttctcaattccaatgtggtacggtgtaacctggattttcactggatacgtgctggcgggaccaaatgaatttaccagtcgatttatcaggtgaacttttttttaaaagacagtcgagtattttgtcggctgctaattcaacacttaatattggtcagttgatgcaatgtcaagaataaaactatacatatgtacataccgtatttcctctattactcttgcagcctttattagtattgcagtctctaatagtcttgcagtttctattagtcttgcacccctacgggtcaatcgaaaattagtcttgcatgcaagactaatagaggaactacggtagatgaattttttttaaaattgttatcaatttatcatttcttgtataattcctcattttgataaaaacaaattttagtgccaacatcaaagaagtgctagatttggaattcgacgactacgtctacttggggccatttctctatgataaaacgggaaatggaaccgcaattgttcatatcaaaccgtttattgggttgggcatcatatcgggaacaattgtgagttatactctaaatttgatgtcaattttcttgtaatttttttactaagctaacttctaataacactttcgcggctcatttctttaaatccaggtttcatccattatcattgtgctaacatttggaattctttgctaccgaagactgaacgcaattgtggttaccacaatgaactcggcaaatctgaaaaatcttcaaagacaactcttctatgcactcgtcattcaaaccttggtaccgttccttctgatgcacatcccagtcggtatcatgtttgcattcgtctttctcgacattgacttgggagtgtacagtgcaatcgtctcaatgacgattgcaatttacccggctgtggatccaattccaaccttggttattgtagaaaactacagaaaaactttaattcgtaagtagaatgccaggctaaagtgaccaaaaaaattgtttaattttagattaccttcgttgttgcaaaaaaccaacagaagttgccgcaacagtcattgagccaacaagatttccgacaaccgtcact