Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52A8.4   

sjj_F52A8.4RNAiJA:F52A8.4
PCR_productsjj_F52A8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52A8.4 Source_evidenceePCR658WS150 Sequence/Annotation Release
Overlaps_Gene F52A8.4 Source_evidenceePCR711WS150 Sequence/Annotation Release
Chunk_score Abs_score606
Max_abs_score606F52A8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73432387345734
Overlaps_transcriptF52A8.4 Source_evidenceePCR711WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52A8.42497gaattttgggaaatactgggaaccgaaacttttaaaaaattgaattttaatagttcatagtctcatagctcatagataacatatttcaaaaaaaaaattcaagactcatttcattaatcttttaacctttccttttacaacatgttccagacttagaaaaccttgttttcagtgaaatgcaagtaatgttttattcaatttagttttcaatcaaaacattctatttaagctttccttttttctcgtagaacatagagaaaggcgtgtcaactgcatcaaattgactcgttaacgaatggacatattacttattccgacactgccttatattcttgttttctcattcataactcagtaatctcgatttcttcttcttcttcttcactttcatttattacaactatgatattattgagatggtatggaactttgttaaatattaaatcttattttttcactgctccaattttaacatctcggctgctttcaaattactactattcattcattttgcactgtggcaattttttaataaaattaaaaaccggccgagttgcagtctacctaaaaatccgatgaagttcggtgattttttaaaattcatcaaacacggttgtattaaactgagatattataaggaaataattatgtttaagtaataaaagttttgattttcagtgtatccgaaaagggcgcctcgttcagtacaccacaggcgaacaggaagaacaaggtgaatggaaacagaaggatgagtgattctaacaatgttgcatacagtaacggttcgaaggtttgttatgagatattattacttataattattctatttcagaaagtctttgaaggtgatattgagaagtgggagccaaatgtgtatgaaaaggtaagcaccgaactgaacaataggaattttaaaaaagttgatttttgacaatttgattggtcagagtagttttaattttttttaaaacttttggccagggatgtgggcctggaataagttgtagtgtgatagcaaatagaacttttaaaacaaatatgtataaattgtatgtgaactagggtacatcctaaccatttcttcaaagcattcaagctgtaaactttcaaattaaaaaaaaaccagtactcactttagaagtacgtctatttatggttaaatcgagaagtaattctataacttttgttcagttttttccatgaacaaaagttttcaaaaattagaagatcgaaaagtcaatgtgcataaaaaagcaaaaaaaaagaagaaatagtgaataagagatgaatctcttctttcaggaattactccgacgcacgtggtcagatgagtttgacaatttgtacgagttgggatcagcaatctattgttacatttttgatcataacccaaattgcaaacaattattcccgttcatttcgaaatatcagggagacgagtggaaagagtcaaaagaattcaggtcgcaggctctcaaatttgtacaggttcgtttttttaaaaaaaataaattagcgagtctctcgtggtcaaacgcgtatttaaaggctgatgggtttattcggttgggtctcgccgcgcgaaaagtttatggtagcaatttttgattttcgcggcgagacccatccaaagaaatatgtgctctttcgagtacgtgtttcagaattttgcaagattacgataaattataaatatttgaaagaaccatcgaaatttttagacattagctcaagtggtcaaaaatatttatcatatggaaaggacggaatcgtttctttacatggtcggacagaagcatgtaaaatttgcggatcgaggtttcaagcatgaatattgggatattttccaggtgagaccctagtgattttgattttggaaattgtgtttttaaggcaattcgcctgatcactgttaagtaaacgtctagatgctaattttcgcgcgaattcgccagatcttgcgcacacgggtctagccacgcggaaatcaaggtactgcaacgcgcgtcgattcttgggcatttaatttgatgcaatatcaggctgtaaatcgacacgagttacagtaactcgttgttcgcgtggcgagacccatgcgcgtaagatctgccgaaaattatcatctgcagacgcctacgtaatatagatttgaaaataattgatcggaatagttgtttctaaattttgaatatctttcacaaatttttgactatgaaattctggtttttatgaatcgttgaaattttataaattttattattcaggacgctatggaatttgcattagaacaccgtctctccattatgaccgatttagacgataatcaaaaaagagacgcagtgacggtgtggaggacattggcactatatacaactgtacacatgcgaaatgggttcattgatggtctgaaaggtgtcaatcgttttccgcctttagtgtaatgttttcaattgttcgcataatcttatccgtaattgcctccaatctctgtgat