Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52B11.4   

sjj_F52B11.4 RNAi JA:F52B11.4
Simmer:F52B11.4:Repeat_a
Simmer:F52B11.4:Repeat_b
Simmer:F52B11.4:Screen
PCR_productsjj_F52B11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52B11.4 Source_evidenceePCR730WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptF52B11.4 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52B11.41171caaatgacagaattgccacgtttgagctgttggatgaggaggctaagccaactggaaaaactgaacagattgaggtgagattgagatgaggttggcctacacattgagcctttgataaaatttgattttcatgaaacttcagtgaagcagataatttttgaatattttttttcttgaaaaattccattgttttacatttctaattattctcaataagtatagaaactcgataatcatattcctataattttcaacttttcaatacactataaaaccgtagttcatatatatttgaaacttggagtatttaaagaattttcagtttatccttttaaaaataacattttcctaattttttccagcaaaatatgtacaatatgctaaagacaacgataaataaaataaaaatccaatttatttctaaaatacaaataaaattgcttattttctgcgagttccgtcctcaaagaaaactcctccatcgatagcacaatactttggacagattcccttctctccagctcctccagcttgtcctggttgtcctggtgctcctggatttccgtcggctcctggttgtcctggtgctccagatggtcccttctgtcctggagctcctggttgtcctggtcctcctggggctcctggggatccagccggtcctggtggtccttgtggtccagcttgtcctggtgctcctggaatagactcggattgagcgtcagctcctggctgtcctggagctccggcttgtcctgggtttcctggtgctcctgaggctccctttggtccagctggtcctggagctccagctccggatccttgtcctggtgctcctggtgctccggcatctccttgtggtcctggtgctcctggagctcctgctggtccttgtggacatggcttgcatggtggtggagtgattggctcacatggctgtgctggtgggcgccctgggtttcctggaagtccagctgctcctggacgtcctggtcttcctggctttcctggagttccagctggtccagcagctcctggaagacagcatccggagcatgaacctccttgagctccctcgcttccttgatcaactccctcatctcctccgtatccggcttgacgggcaaaacgagaagcgttctttggtgaagaacggatgtggtttacctcg