Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52B5.2   

sjj_F52B5.2 RNAi JA:F52B5.2
PF:GL1_1C11
PCR_productsjj_F52B5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52B5.2 Source_evidenceePCR655WS150 Sequence/Annotation Release
Overlaps_Gene F52B5.2 Source_evidenceePCR952WS150 Sequence/Annotation Release
Chunk_score Abs_score889
Max_abs_score889F52B5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI83158868317580
Overlaps_transcriptF52B5.2 Source_evidenceePCR952WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52B5.21695gaagtgaatgggtccacattttactttatcttttaaacaacattcaaattatacacaacaatatcaagcaattaacaagaattacacgtgatttgggcgactagccgtaatgattgaggtaatataataaaaatataaacatatgtggatatttagcaaatgaaagtgatagcataaccagacaatattgaaataaagtgcttaattggaatgggaaacttacaaatttcaaaaaaaaatgtgttgatctagaaaactttttaaaactcaaaacaggccttgttttctagattcgtctgtacttttaaaattaaatagaaaattgaattggaaatagtaataagaataattgaaattagttagcctgtgcacttgcctcctttttgaaatattcatgattgagaacttgtgatgccatcaatcgcttcgtcggatcatacttcatcatttgttccatcaaatcagctgcttcttttgtaatattctcgattttcgaaaatgttttctcaccaacgggtggcagctcgatggattgcattaagggaagtttgtccatttccggccacgtctccttcgtatgatttccaagaagaagacgaattgcatggatcttcaaaacagaaaattatcatttcatatattaaaagtggagtaaaataattttgaaaagtgatgacttttatagaatttataaaaaactttctaaatttgttatgatttttccaattttgaaaaaaattagagaaaagatgttgcgttttccggcaatacagttcggtttttcttttgttttatatatctaaacatactttgtcaatttttgagacatattttccgcaaaagttttttaaaattaaatctaccagttttcatgaactcaaaaagttagaacaaacgacttactgtttgcaaattggaattctgagagaaaagatgacttccttgaaacattgcacccaagacgcaagcagcagcccaaatatccatagatttagtgttctccttataccccaatatatgttcgattgtgagatacggtagggtgccaggtttaacaactttgtctgaggtgctgagaactgtctccccgaaatcagcaatgcagatggtttcaccgtcgatcagcaaattttccggctgaaaatatgaatatatactttcaagccaatgtccactgtcggctctaaaaaaatgttgaaaaagttttttcaagtggcaagcattgaaaaatcacaagaaaaagaaatgcatatatgaaaacttgttttgttgaagttaaatatccgtgaattttgcaaccagcagcgtcgcatagaaaaataggcggagcgtaattgcgcaactctgcagcaacggtttccccgtttttttttaaatttctctcaatgaagtttcgattttactgttttcattcttttttcgaatgaaagtgttatccaatttaacatgttttaaaatcaaacatccgcagtctttttgcaaaattcacggatcgataatatgaacagtacacgacgatatatgcgaaccttaatatctctgtgaatgtaatccatccgatgaataaattgaagtccttccatcaatcctttcatatacttttgaatagtagatggttgaagtcgttggcggtcgccgagtattccgaacaagtcagtttcatagcgtttgaaaaccattcccaaacgtatttct