Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52C6.12   

sjj_F52C6.12 RNAi (5)
PCR_productsjj_F52C6.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F52C6.12 (3)
M7.1 Chunk_score Abs_score91
Specificity_index0.198
Rel_score0.247
Overlaps_transcript F52C6.12.2 Source_evidenceePCR354WS150 Sequence/Annotation Release
F52C6.12.1 Source_evidenceePCR452WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52C6.121156tcgaaagatgaatcaacgaaaatttcaagttttaactgtcacaggaggaatcgaaaatgctacttcatcgatggacatgtctgtagagaattcttcaaccttttaacaatagatttaacaaaaaaaaactttattcccaataaactataaaatcttgacgatttggttttgtacctcctcggcggtcatcttttgccatgatggaaccgagcgacgaccgacaatctccgattttaccagccgcaacagcctcgacgacgagcttctcgacgtttcaactgaaaaaaacaattttagtgggaaaatgaagtatttaagatttacagaagatcaaacttactgtactagtcgattatgttaacggtgatgacaatcgtggagtgattttcagactcgttcttgttgccgtgatggaacggagcggcggtatcgttgttcatccggatttggatcacagagcagcgagcagatcgaaagcagaactgaaaattaaaagttataactcgaacaatattgataatatcaacctttcgaaatggtcagagtcggcgaccactgaaaacgcagaatgtcaagaagttcggatggcaaattcgagtggtgaaatcaacctgaaaataacgtaaatatatattgttttccaattttgataaatgcctttggtggtttgaatggatagtctgtcgagaagtgatagtgaggaagaagatacctccctgatagggagactctggtgggcccataatcgtagcttgccaatggtacaaatcatcaccaactgatccagtggagcattgtgcgggtggatcacggccgagatcatggagttcctgaaacgtacataatatttatatcatttaatgttgcaagctcactttctggattcttttgagagccatgttggtgttctgatttgctcctcttttgccatgatagaacggggcggcggcatgggatggacgacaatctccgatgtttcagacggtagcagcctcggatatgtctcgtcgaggagatctgatcttgcatcagctttgcgcgtagtggttgtaggcagaggcatcttccatgtcaccgacggcagcagcttcaacacagtgctcctcgaggctcaactgaaaattgaagaattttactgggaaaatcgagtatttcg