Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F52F12.2   

sjj_F52F12.2RNAiJA:F52F12.2
PCR_productsjj_F52F12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF52F12.2 Source_evidenceePCR748WS150 Sequence/Annotation Release
Overlaps_Gene F52F12.2 Source_evidenceePCR748WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666F52F12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98939079895092
Overlaps_transcriptF52F12.2 Source_evidenceePCR748WS150 Sequence/Annotation Release
WB_DNA_textsjj_F52F12.21186gtgttggagatgcaatgaatgtatctgagattggagaagatccaccggaaggtgaaactcttgaagatgatcgacgaggacatggacaatagcctggaaattataaaataaggaaaatagaaatcgatttcaaagttgcaagtttctcatagtcagagttagtttcaaagtaatggttgtttcaagatcgtatgtcttgtagtagcaccgactttcaaggttttttgggtctacagtgttttgaataaatttccagcagtcgaatttttgaaataatacgtcagaattaacaaaaataaaagtttgataattcctgtaaatttaaccacgtagacatgtgttttgtagatcgtgagttaatatttcatgttttcaactaaccggaatcgaacccaggaactccttgctcgcctggaataccatctggtccttcttcagctatatctcctatatttccagctggtccttctggtccttcaggtccatcatgtccgtcttctccagtttcacctgttactccaggcattccgacttctcctggaggacccggtggtcctgctggtccaggaattccaactccacgagttgcattgtttccttgttctccattctcaccaggtgcacctgggaatccagggaatccgatgaatcttgaaattgaaaattagaattctgagtttgactagattcattttgaggattcatttaaaaaatgtatattgaatatttttaaagtataatactcaccctggttccccatcagttccagattctccatcttcacctggttttccaggacttccaggttgtccatcttctcctttttctccaacagaaccattttctcctggtggtccaggttctccagcaacacatggaatacattcaacaggaccaatcatttctttgaatacatccattccatccggaccctttcgtccttgacctccgtgtggtccatcggctccttttcttccaggcctaccacgtgggccatgtgggcctactggacaattgattgctggtcccgtatcacaatcacatgggtctttatttgaatccggagttggagaagcttcacgaggaaggcgagttgctgggagcatatcttcccatgcaccgtttgcatacaactgaaaataatagtaaggcctctgcctctggagtcactgagcaaagttgaggt