Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53A9.10   

sjj_F53A9.10 RNAi (4)
PCR_productsjj_F53A9.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53A9.10 Source_evidenceePCR1007WS150 Sequence/Annotation Release
Chunk_score Abs_score923
Max_abs_score923F53A9.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX87216808722856
Overlaps_transcript (6)
WB_DNA_textsjj_F53A9.101177gggtatgatgacggttggagcgtttaggctggaacggcctcggcagcagcttcactatctgggatcacaacctcctgaaaataatattgtttagagaaaatgtatgaatcgtgtacttacagctccctcatttggattttggctttgaactggtccatcttcaaactccttatctggaacttgaagtggaattgggttgactggtggcttggctgcatctccctcggctttcacttgttcgacgtactttggtggttcaaggttctttctggaaaaacgaacgaatatttttcatttttctttaaacacacacctgatctgttcaagttcctcgttctctttgcgtccccattctgctggcggccgggatgttccgtggacaagggtgtaggctggcttgacgaatgggttttcgaagaggtaacgacgatcaccatatgatcttctgtcagtctgacgatcgaacttggaggctgtggtgatcttaggtggatggacggaagaggcggcttcctctgggtcaagtcctttcttgagggccttgttacgagcaacttggcgttgacgctcgttgagctctttcaactgaaataattttttgggtttgaaagatttggaaatttatgaatttaaaaaattaaacccgacgataaaagctactcacgtcgtactcttgacgctcacgtctcttttccaaatcgtacttttctccctcaagcttgacaatacgggcatgaattcccttgattctctccttcaaatcgtttggcatgagtgttgaaacatcttgggccttgcaaacaacgttcaaaaaagctctcttggcgtcctcttgttgttctttggtgagtccttcagccttggctccttgagcaaggtttccgaagttggcggcttgatcgcccttgttggaaacagtgaagttctttcctcctggggctccaacggcagctccggcgaatgatccagccatcatttgctgacgacgggacttctcctcgttcttgcgagccttctccgcatcagccttagctttgcgatcttcctcgtccttgcgacgtctctcttcatcttgacgtcttctttcggcaaactgacgctcgtcttcctcacgctcagcacgacgtttctcttgtttttctttaagctcacggagctcttgctccatttgctcctt