Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53B6.6   

sjj_F53B6.6RNAiJA:F53B6.6
PCR_productsjj_F53B6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53B6.6 Source_evidenceePCR875WS150 Sequence/Annotation Release
Overlaps_Gene F53B6.6 Source_evidenceePCR875WS150 Sequence/Annotation Release
Chunk_score Abs_score812
Max_abs_score812F53B6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89545698955615
Overlaps_transcriptF53B6.6 Source_evidenceePCR875WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53B6.61047cgcttggaagcatgatgtaataattgtcgatttctttgacgagttactaaaaattttacagtaacacaacagaataatgcaaggaggatcgccgttgagaatattactgtagatgtcttggacaaacaaacttcagaagatgattggaatgatagagattgtggtggaatatttgtgtctgaaaatttattagatttttaaggaaacttggatttttttaaaattatattttacaaagagccgcgaaacgtttcttttctaattttaaacaccctctgaattaagataagtttagaaaaataaattttggagcaattctaggacctcaatagtaattaaaaaaataaactgaaaaaatttcatatgaacatttatttaaaagaagatgaacaatttcttttcagataaactttgaaaattcaaaccttttcgctctttatcctcaactggaagaacgataacatcaacggaaacatcagtttccatatctcctgctgttctccgaactttggttgatgatgaagttgagggagtacttgattcactacctcctcgccgaaaatctatattcatactgttttttgcatgaacaactggcttaaatgtcacgaaatccggtgtatgggatacagtaggtacagtagttcttaatgtcactacttgcataataatatcatcttccgatgtatcatttattggactatcacgacgataaggatttggagctgactcatcttcttcatttattctttgaatttcttttggtcctttgaatggtggaacatgatgtggtggtgaaccatctttatggaatactgttggatgtggtggtccaagaataattggttggaaggtatcaggcttaatgtatccaggaacacgtggagttgattcaaatgaggatcccaaatcgttcccgttgtggtgatccgtttcaggctccaagtttacgaacttgtgctctgctgggcctttagagccacggataccatgtgagtgtccagaacattgaggaggtgttataccctcacaaccaccgtcatgttt