Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53B6.7   

sjj_F53B6.7RNAiJA:F53B6.7
PCR_productsjj_F53B6.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53B6.7 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene F53B6.7 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score657
Max_abs_score657F53B6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89532178954326
Overlaps_transcriptF53B6.7 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53B6.71110agtcccctaggtggcttgattttttttaatttataaaaatttacgaataggaggggggaagtctattaatatcttttacgagcttttaaagacttgagtatgcagtttataaacatctccatggaatgttggagccacgaaaaaccacaccaatgaataaatttgcagtgtctcatgcggaatcaatgggtttgatctttccaaattgggttcgtgtctgttatcgtcgtggtccaatggaatatcatccatatgatatgaatatgcctccaaaattagttcctagaccacctttacactacaaattcgatcctccgctcactgaacgtgggcaaattgtgtctgaaacttatgggcgtggtctgttgaatgccggaattcgtccatttgaagtattttgctctcctgacatgaaatcagttcaaactgcagctttcttgattaaaggacttggtctttcctacaccaccgttagttttttgtcccttgtatgcatataaagaaaaatttcagatcaacattgatccagctcttctcagctatcgtcaaatgttgccgactaattttcaagaaatgttgctctctccaaaagcggtaattgttacaaaaataaacgggagactaagatttggaactttcagtttttcaatatgggttatccaatcaatatccaatatcttccatcgcaaggatttattcgtgcagagaacatcgaagactacaacttgcgcattcaagcatttttcaagaaaaatattgcaaaaattgagcaaaagtacgtgtcagagaactattattggtactgattccaacttttcagacaagtggtcgtgatttctgataatgtgatggttgacttgacacgaaatgagcatgtggagactgtcgatgatattttgcaatgcatcaagaagcccacctgccaaatgaactttatttcgctcaagaaaggagaggttcattttaagcttttcatataatattcttctttaatttttcaggcacaaattatggattccccaatattgccactcactaagagtctttacttggtgaagccattctactggaccgatgttcctcttcaattatcggttccaaatcatcctg