Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53F4.11   

sjj_F53F4.11 RNAi JA:F53F4.11
Simmer:F53F4.11
PCR_productsjj_F53F4.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F4.11 Source_evidenceePCR749WS150 Sequence/Annotation Release
Chunk_score Abs_score707
Max_abs_score707F53F4.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1362566913626775
Overlaps_transcript F53F4.11.2 Source_evidenceePCR749WS150 Sequence/Annotation Release
F53F4.11.1 Source_evidenceePCR749WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53F4.111107atttaggcactttttcggcagatatgcatccaattttggttatttttaaaagcctgtcgaactaaaatgtgaaaaaaaatcagtaacaaacgactagaatatatgatttaccgataaaactgtattctaactgctgcgaaaagaaaaagttggaggaaaatttccgattttctgaaaattcgagttttttgtatttttgacaaaccgttaaaaaaacccgaatttttaaaaaataaatcttattctgaaattcggtggttgaatttttcttgttttgttagtataaattaaaaattgacagaacttacgatctgaccatgtatcttctcaatggatagacaacagttctaagagcattttcaattgcagtactgattggcttttgatagacgaatggaagtggacacttgtgcgctctgtagaattcttttcccaggaatgatttcactgaattgtagacgcggccgtcggaaaggaacacatcatacgtcgaagccaacgagcgcttgtccttgtaagtgtgtgcaattctttcaacttcccgctttgtcaaaatcttggcgatgtgagcagatgtaagtccgtggtcaacttcgatcttttcagcccactcacgcgattgtttctcaacatcgaaatcacgtttagcagcatcggattggtcaagatctggcatgataacacacactgatgtattgttgatgttacgagtgctgtgtggaagcttactgaaattaatgaaattataaattgccatttggaatacgtgaaaacttacatcttgatttttccttgatcggtggtgatagctgattttttataggtgaccgaaagattgagagcataatcaatatcagggaacaatgatttctcatttttctcagcgaaaaatttcttgagagcactaatagcttgtggtgcctgatcctttgcgtcctggatcgatccttcgtcatccgcattgactttcgcaacctttttcggtgaagtactcttttcttcttcgatttcctcatcatcactcgactcttcaactgtatcgttctcttcttccttcttcgcaacttcaactgaaggagcaactgacttcacaacctgcagctcatc