Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53F4.14   

sjj_F53F4.14 RNAi JA:F53F4.14
PF:GL1_2H8
PCR_productsjj_F53F4.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F53F4.14 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score807
Max_abs_score807F53F4.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1363022913631223
Overlaps_transcript F53F4.14.2 Source_evidenceePCR870WS150 Sequence/Annotation Release
F53F4.14.1 Source_evidenceePCR870WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53F4.14995attcgatgtgtgaagagttcgatatgagtgcgacaaaacacaacgagagagttggacgacgaaatgatcggaaacgcgacgcaagtcaggcttgtcttccaggtttgtttttattttttaactttcactaatcatatttttcttaaaattaaagacgtctatttagtattaaattttacagaacgttctccatcgctacgctcggaacctcgccaacagcgtagtcacccataccttcaaactcgtacaaacacacatcgtcagcgtccgatgatccgtccttcatctgttgtttcaatgtctggaagatccatagcaccatcagatagcagtgaaaatgatgatcgtcattttgatgtcgatgaagaaatggaaagcatgtcgttggattcaccacttcctattgaagttccagctcgtccatttccagacaagccatactactggatgaatgattataagacattggagttcatccgaactaatttcccatcggattctttttatgtcatgcataatggaaaaattattgaaaatttcaatgcttttatcgatgagaacatgggacaaagccttgtcaagtattcattccatctcagagttcgtggtggaaaaggtggatttggttctcttcttcgttcatttcgtgttaataaaagtacaaataaactgatgatgagagatttaaatggacgaagaatggcatctgttgatgaagaggcaaaattgaagcgttatttggagaaacaagcgagaaaagagcaggaattaaaggtaatgcttaacttcaaaaattttgaacacgtttcgagtattacaggagaaacgcaaagcaaaacttgaaaaattaaccgctggaccagcaaaacatatgtttgaagatcaagattatctgtcacgtcgtgaagaaataatcaataaaactgaagatgcttgtgaagctggtttcgcattgatgctagaaatgaaaagaaattcgaggaaatcaaaagagc