Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F53F8.2   

sjj_F53F8.2RNAiJA:F53F8.2
PCR_productsjj_F53F8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53F8.2 Source_evidenceePCR817WS150 Sequence/Annotation Release
Overlaps_Gene F53F8.2 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score668
Max_abs_score668F53F8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2067930520680942
Overlaps_transcriptF53F8.2 Source_evidenceePCR817WS150 Sequence/Annotation Release
WB_DNA_textsjj_F53F8.21638tcatttcagctgccagtcacaattttttttttgaaaataaagaaaaagtttctccttactgtgaatttttgcgatctgccttatcaaaaactgtaaattgaaatccgatttcgcactttttcatttttttttctagtaacctccagtaccgaattgtattataggaaaatggagcttcttcttatcattcttctgtttatttactcaacaatttttgtggtcggtttcacaggaaatttgctgatggttttggtaacgctacatagcaagtgagttgcaaatcttaagcacgttcgagcacatattgaggttttttccagaaatctaagatccatttgcaatatgctaatctgtgtctgctgcttttgtgatcttctgcttttcaccgacatcatagcttttgtggtgtctatgtttataccaataacgcaaggtgagtcaattatctttgataatgaatttgaaaagtaaattatccagagttctgcttctacatcaatatcccggcggattttggagcattcgcgtctaatgcatgtgtcttagctgttggaattgataggctcattgcggtagctgctcctacaaggtatacaaaacactaacgcaaattcttgcatttaaaaaagtaatggcggaaacttttaaaaaaagtagtgggggctccctgctgggtgaggcgcgaaacctcacgccgaagtcgcgccgctgtgtgcaatgaagttcaaaaggtagttatttggaagcggccgacacgtttggggttccgcgccgcactatacatttggatacatgcggcgtgagtgatgccgtgaggccggcgcggccgccgttgcggcggccccatgagagccctaggttgaagaatggtacgttccatctgctgatctaagagtcagttaaaagtcagttggtagcgagttaacaaatttacccactgggcaaaacttatgataattcaaaattctcacttgttctctctatgtgtacagtaatcttacactacttcagatacaaaatgctagaacacgaacgctacaagtacttcttcattttattggcgtttccaatcatatactcctctgcgttgttaatcatgggatttgggcaacgggacccaaaaaggtaagcagttttacttaaattccggcaatcaagctactttttagaaatgtcgtttgcctactcccggaatcattgggtcatgcctatgatatgtttgctctcacctcgtttgtcataaatctttttgtaccgcccatctacgcatatgtgtattttaagatcaaaaatatgagaatgagtaattaaccaacgagaagttgaggaaattctacgcttaaatttagatagctcaatgaaagcagtcttcaaatcattaatggtcactgtatgccttgttgtatgtggttggatgacgactgacttgattggtgcgcttacggtaacactgccaatggataaggacgtggcaagaatgattcagttgtactgcggaacgtttatattcacgtcgagcgcatttaatgccgtggtgtattacaaattgaggtaatttgaaattttttaattctagcccaaaacattctttcagtcgagactaccgttcagcaatgcgcacaatgcttggtctctcga