Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54A3_30.c   

sjj_F54A3_30.cRNAiJA:F54A3_30.c
PCR_productsjj_F54A3_30.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54A3.4 Source_evidenceePCR677WS150 Sequence/Annotation Release
Overlaps_Gene F54A3.4 Source_evidenceePCR677WS150 Sequence/Annotation Release
Chunk_score Abs_score616
Max_abs_score616F54A3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII22220382223233
Overlaps_transcriptF54A3.4 Source_evidenceePCR677WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54A3_30.c1196agatagtccctgattccatccatcagaaccaccacgaccactgacccggctggaagatccttggcgagtttgatggcttccagcactgccgctccggaagatggtccagccatgatcccttccgtctcgatgaggtgtctggtgaaggtgtaggattcaggagcatctcggatttccaccttgtacttctgcagaagaacttctgtttctggagctggagctgaagctgaagctgaagctgaagatctcactccgaccactgttgtcttctgatcctttaagaagtaagcagcgatccctgctgccgctgaagctccaccagcatccaggggtaccacaactgcactggtcttcccagccttctcaatctccggtgcagttccttcaagattcgccagaaacgcggctttctcgcagatcccatcaagattgtagacacctcgacgcttggccagtagatcagcctggagccgagcttctcggaagtttgaaaccgggagctccacgatcttggttcccaaagtgctcagaatcgtcctgacctggtcgaatgctccgggaggtgcgtgggcggttagtctgacccccttgacggctgccacggtggcataggagactgcagatgatccgccggcggtcacgtagacctcgtcgcctcgttggattccgttggacatctgaaaaagaaaaaatcaattaaaaaaatttgtttttgagattttagattactttctgggattttttattatcaaattcgaattcctcgccattttctgagtctaaaactcaattttcagctcaaaactcgaaaatcgcgtgaaattcggtgtttgcgtacttttggcgctaccgtaccccgagaaatttcaaaattgagctagaaacctctagttttcgattttccgactgaaattttaagataaattcgaatttagcagcgaaaattggtaaaaattatttttagtccattgtgaccaaaaattttaactgacacctataattttgtgactattcccggaaatgtggaaaattttaactaaaaaattcgaatttcccgcaaaatttgctaaattttaaaccccatatcgaccagattcggttaaaaaccagaaattcggcaatttttccgcgcgttgcggccgcgtcgcggtcgaagctggaaattcttcaaaatgaagcgattttcagctagtttc