Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54A5.1   

sjj_F54A5.1RNAiJA:F54A5.1
PCR_productsjj_F54A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F54A5.1 Source_evidenceePCR915WS150 Sequence/Annotation Release
Chunk_score Abs_score873
Max_abs_score873F54A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI990312991894
Overlaps_transcript F54A5.1.2 Source_evidenceePCR915WS150 Sequence/Annotation Release
F54A5.1.1 Source_evidenceePCR915WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54A5.11583taaagttggctaaagggaaaaggggactctggatcttaggcgagcaattctctgcagccggcaccagaatcgatcccccggtgcctggatatctatccttcgctgttagccactgcgatatgccccacccgcgctgagatcgaaccgaggcgtctgaattcctaggcgaagttgctacccactgcgccatgtcaatcttctaaatttccaggagtaagccagccgtacatttcaaaattgctcaacggcaaccaccgtgaactatcgctccgttgccgtaagaacatctactgttggtacctgaactgccgacgtcatcccaacaaactcgctgccttcctcgccgatccgacaactcgcctcgagacgaatggagatggcgagctgatcccacaacgtcgagaacgctacgtgtttcgtccaattctgatccgaatgctcgaatcgttcttcacacaaacgccattcccagatcttccacggcgagtcgaaatagcgaatgcttgcaatcacgttctgaagatggataagaaaggtgttgggttgatgccaaaggaggtggtcagccctcaagtcgtttcgaattggtttgcaaataagcggaaggagttgagaagaagatccgctgaagcttcggccgcctccacctcgtccgcttcgtcttctgcgtcatcgactgctaatcatgattctgtcagtgtgtccagcatgagccctcgcgatgaagaggtgagagttttaatttctcggccacgctgtactctgggtggaagaattttttctaggtcttataaggaatcgccctccggttttcccacaagttaagtcataaacatgtaccatctagaggttaaatttctggagttttatttatttgagagtgatggtaaacctgtcagtccttggcaaacatgtgtctgtttggtctcaaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtcttggtctaggtctaggtctaggtctaggtcttggtctaggtctagttctaggtctaggtctaggtttagatctaggtctaagtctagacacaaatttctaggccacgaaaatttctgccgtggcctaggattttttaggccatattctaggccatgatccaaaaaaaactttccctgtctcctctaacccattttttttgcagacaagctcccgtaacacaaccccggagacagcaatctccccgtcaccagcagtgtccacttttgaagtgtcccgcccgtctgccatcatctctgccacgtcatcaacaacctcgccaatctcaattccagcaacaatcattccatcagtatcgccgtcagctctcgaacttttcgccatggcccaacagcttggagttcagcttccggttccatttccaacattgccaacacactttttcccgtttcaaatggctccgttctacgggaacccggcttctattttgaagtctgagtgaagcatttctaattttcttttcttcttttctacaccaatatcttttttccatttattcaacttattcttcatcccatgacacgaaaacctcaattctttca