Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F54D1.3   

sjj_F54D1.3RNAiJA:F54D1.3
PCR_productsjj_F54D1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54D1.3 Source_evidenceePCR933WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptF54D1.3 Source_evidenceePCR933WS150 Sequence/Annotation Release
WB_DNA_textsjj_F54D1.31196tttccactttgctacaattcgatagagcttaggcaagtaaaatggaaattgtttattttgtacgtttaaaagaaatatgacaagaattgagaaaaaccattttaatgacgggaaaggaaaacagcggatcttggtgggcaggcacaataagcggcatcgtttcctggaagtcctggtcctcctggagctcctggttgtccatcggatccattgtttcctgggaatccgtcttgtccggctggtccagctgatcctggtgctccatcttgtcctgggaatccatcttgtccagatggtccagctggtccagcatttcctggagctcctggtgctcctggagttccagctccacgttgtccatcggctcctggttgtcctggagctccatcttgtcctgggaatcctggttgaccattgtctcctggtgctcctggagctcctgggaatccatcgtttccacgttgtcctggagttcctggttgtccagatggtcctgctggtcctgctggtccggatgatccagctggtccggctggtcctgctgggcacttaatgcaatcgaatgaaacttgtgggcagttgattggagcataggtaacagtgctgtcgccccctcttggtcctggagctcctgggactcctggtgctcctggctggcctggtggtcctggtggtcctggtgggcaagttggcttagttggctcacactggcaccaagctggaagtccagagaaagtttgacgcttttgacggaagacagagttgaatggattgacacgtggcttagttggtggagtgacagtaacctgaatgtccatcatctcggtccaagcagaatcggtttcaacacggaaaacggaaactccatcaagaacctgaaattaattaatgtgatgaagtgaaactgtatgaataacttacttgatcatgaacttcgttgatggtattgtagagagatggaacagtgaaaagaacagccaaaactgcaatggatgcagctccagttgagatggttacaagaatcttctccatgtcgaaatggtaccttttctcttgtatttcttttctttttatactcatcttttcttcattctttatgaatgtgttactcctacacttttttgcaataaggtggaagagtgtaaagcaatattcagttaaaaacattacttcctcattaaaaggaagaagccaca